Incidental Mutation 'R5474:Scfd2'
ID433968
Institutional Source Beutler Lab
Gene Symbol Scfd2
Ensembl Gene ENSMUSG00000062110
Gene NameSec1 family domain containing 2
SynonymsE430013M20Rik, STXBP1L1
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location74204816-74531759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74531364 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 86 (V86I)
Ref Sequence ENSEMBL: ENSMUSP00000121098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072857] [ENSMUST00000075848] [ENSMUST00000080164] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000113542] [ENSMUST00000120618] [ENSMUST00000151474]
Predicted Effect probably benign
Transcript: ENSMUST00000072857
AA Change: V86I

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072636
Gene: ENSMUSG00000062110
AA Change: V86I

DomainStartEndE-ValueType
Pfam:Sec1 25 668 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075848
AA Change: V86I

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075245
Gene: ENSMUSG00000062110
AA Change: V86I

DomainStartEndE-ValueType
low complexity region 458 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080164
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113534
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113535
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113536
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113542
AA Change: V86I

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109170
Gene: ENSMUSG00000062110
AA Change: V86I

DomainStartEndE-ValueType
low complexity region 471 479 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120618
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121950
SMART Domains Protein: ENSMUSP00000113611
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 153 195 6.6e-29 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
low complexity region 503 557 N/A INTRINSIC
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135377
Predicted Effect probably benign
Transcript: ENSMUST00000151474
AA Change: V86I

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121098
Gene: ENSMUSG00000062110
AA Change: V86I

DomainStartEndE-ValueType
low complexity region 458 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200979
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Scfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Scfd2 APN 5 74530934 missense possibly damaging 0.67
IGL01094:Scfd2 APN 5 74531046 missense possibly damaging 0.69
IGL02928:Scfd2 APN 5 74531171 missense probably damaging 1.00
IGL03365:Scfd2 APN 5 74530935 missense possibly damaging 0.67
BB009:Scfd2 UTSW 5 74531550 missense probably benign 0.33
BB019:Scfd2 UTSW 5 74531550 missense probably benign 0.33
P0035:Scfd2 UTSW 5 74225319 missense possibly damaging 0.89
R1696:Scfd2 UTSW 5 74530878 missense probably benign
R1857:Scfd2 UTSW 5 74212301 nonsense probably null
R2136:Scfd2 UTSW 5 74206367 missense probably benign 0.01
R2205:Scfd2 UTSW 5 74225367 missense possibly damaging 0.93
R2504:Scfd2 UTSW 5 74531177 missense probably damaging 1.00
R3864:Scfd2 UTSW 5 74397720 missense possibly damaging 0.49
R4439:Scfd2 UTSW 5 74397707 missense possibly damaging 0.69
R4590:Scfd2 UTSW 5 74212256 missense probably benign 0.01
R4703:Scfd2 UTSW 5 74519595 missense probably benign 0.00
R4901:Scfd2 UTSW 5 74519565 missense probably damaging 1.00
R4916:Scfd2 UTSW 5 74462658 missense probably damaging 1.00
R4970:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5112:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5706:Scfd2 UTSW 5 74206398 splice site probably null
R5766:Scfd2 UTSW 5 74462651 missense probably damaging 1.00
R6769:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6771:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6961:Scfd2 UTSW 5 74519541 missense possibly damaging 0.86
R6963:Scfd2 UTSW 5 74482209 missense probably damaging 1.00
R7151:Scfd2 UTSW 5 74397665 missense possibly damaging 0.56
R7159:Scfd2 UTSW 5 74531343 missense probably benign 0.01
R7510:Scfd2 UTSW 5 74212327 missense probably damaging 1.00
R7602:Scfd2 UTSW 5 74462610 missense probably benign 0.32
R7678:Scfd2 UTSW 5 74458636 missense probably benign
R7932:Scfd2 UTSW 5 74531550 missense probably benign 0.33
R8074:Scfd2 UTSW 5 74519596 missense probably benign 0.00
R8088:Scfd2 UTSW 5 74531363 missense probably benign 0.12
R8511:Scfd2 UTSW 5 74212288 missense possibly damaging 0.84
R8725:Scfd2 UTSW 5 74482239 missense probably benign 0.01
R8837:Scfd2 UTSW 5 74530995 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCGTATAGTTCTCGTTGCC -3'
(R):5'- TGGCCAAAGTGAAGTGGTCC -3'

Sequencing Primer
(F):5'- GTTGCCCATCCACTCACAGAG -3'
(R):5'- AAGTGGTCCGTGGTCTACC -3'
Posted On2016-10-06