Incidental Mutation 'R5474:Clec4a4'
ID433970
Institutional Source Beutler Lab
Gene Symbol Clec4a4
Ensembl Gene ENSMUSG00000059639
Gene NameC-type lectin domain family 4, member a4
SynonymsDcir2
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122990367-123024105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123012747 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000078351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079379]
PDB Structure Crystal structure of C-type lectin domain of murine dendritic cell inhibitory receptor 2 (apo form) [X-RAY DIFFRACTION]
Crystal structure of C-type lectin domain of murine dendritic cell inhibitory receptor 2 in complex with N-glycan [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000079379
AA Change: S116P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078351
Gene: ENSMUSG00000059639
AA Change: S116P

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 230 1.72e-32 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Clec4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Clec4a4 APN 6 123024016 nonsense probably null
IGL01659:Clec4a4 APN 6 123023935 missense probably damaging 0.98
IGL02455:Clec4a4 APN 6 123013780 missense possibly damaging 0.94
IGL02726:Clec4a4 APN 6 122990379 missense probably damaging 0.99
IGL03241:Clec4a4 APN 6 122990373 missense probably damaging 0.99
R0751:Clec4a4 UTSW 6 123012712 missense probably benign 0.12
R1184:Clec4a4 UTSW 6 123012712 missense probably benign 0.12
R1455:Clec4a4 UTSW 6 123012799 missense possibly damaging 0.60
R1474:Clec4a4 UTSW 6 123012744 missense probably benign 0.01
R1514:Clec4a4 UTSW 6 122990442 missense probably benign 0.26
R1779:Clec4a4 UTSW 6 123023975 missense probably damaging 1.00
R2138:Clec4a4 UTSW 6 123023978 missense probably damaging 0.99
R2182:Clec4a4 UTSW 6 123013757 critical splice acceptor site probably null
R2207:Clec4a4 UTSW 6 123013807 missense probably damaging 1.00
R3817:Clec4a4 UTSW 6 122990407 missense probably damaging 0.99
R5917:Clec4a4 UTSW 6 123004058 missense probably benign 0.25
R6164:Clec4a4 UTSW 6 122991874 missense possibly damaging 0.89
R6628:Clec4a4 UTSW 6 123012804 missense probably benign 0.23
R7212:Clec4a4 UTSW 6 122991745 splice site probably null
R7399:Clec4a4 UTSW 6 122991829 missense possibly damaging 0.86
R7808:Clec4a4 UTSW 6 122990380 missense probably damaging 0.96
R8370:Clec4a4 UTSW 6 122991799 missense probably damaging 1.00
R8515:Clec4a4 UTSW 6 123004023 missense probably benign 0.25
X0013:Clec4a4 UTSW 6 123023912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGAATTCCTGAGGTATTATG -3'
(R):5'- TGTCAACAAAACTCCCTCATAGTAG -3'

Sequencing Primer
(F):5'- ACAAAGGGTTTTGACATTAGCG -3'
(R):5'- TAGTAGAAACAGCAGACAACCTG -3'
Posted On2016-10-06