Incidental Mutation 'R5474:Zfp84'
ID433971
Institutional Source Beutler Lab
Gene Symbol Zfp84
Ensembl Gene ENSMUSG00000046185
Gene Namezinc finger protein 84
SynonymsC86188, 4633401C23Rik, Zfp69, KRAB18, 2210410P13Rik
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29768552-29779821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29777089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 402 (S402L)
Ref Sequence ENSEMBL: ENSMUSP00000032802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032802]
Predicted Effect probably damaging
Transcript: ENSMUST00000032802
AA Change: S402L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032802
Gene: ENSMUSG00000046185
AA Change: S402L

DomainStartEndE-ValueType
KRAB 14 74 9.09e-36 SMART
ZnF_C2H2 249 271 1.67e-2 SMART
ZnF_C2H2 277 299 1.43e-1 SMART
ZnF_C2H2 305 327 5.81e-2 SMART
ZnF_C2H2 333 355 1.95e-3 SMART
ZnF_C2H2 361 383 8.6e-5 SMART
ZnF_C2H2 389 411 2.32e-1 SMART
ZnF_C2H2 417 439 3.89e-3 SMART
ZnF_C2H2 445 467 1.69e-3 SMART
ZnF_C2H2 473 495 9.58e-3 SMART
ZnF_C2H2 501 523 1.38e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158514
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Other mutations in Zfp84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Zfp84 APN 7 29776666 missense probably benign 0.16
IGL03022:Zfp84 APN 7 29775334 splice site probably benign
R0666:Zfp84 UTSW 7 29776851 missense probably damaging 1.00
R0781:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1110:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1353:Zfp84 UTSW 7 29776175 missense probably benign 0.02
R1495:Zfp84 UTSW 7 29777303 nonsense probably null
R1496:Zfp84 UTSW 7 29776614 missense possibly damaging 0.53
R1681:Zfp84 UTSW 7 29777400 missense probably damaging 1.00
R1827:Zfp84 UTSW 7 29777343 missense possibly damaging 0.91
R1854:Zfp84 UTSW 7 29775371 missense possibly damaging 0.84
R2209:Zfp84 UTSW 7 29777182 missense probably damaging 0.99
R2843:Zfp84 UTSW 7 29775333 splice site probably null
R2844:Zfp84 UTSW 7 29775333 splice site probably null
R4691:Zfp84 UTSW 7 29777080 missense probably damaging 1.00
R5453:Zfp84 UTSW 7 29776297 missense possibly damaging 0.82
R5578:Zfp84 UTSW 7 29775431 missense possibly damaging 0.93
R5646:Zfp84 UTSW 7 29776393 missense probably benign 0.05
R5963:Zfp84 UTSW 7 29776953 missense probably damaging 1.00
R6830:Zfp84 UTSW 7 29776486 missense probably benign 0.00
R8129:Zfp84 UTSW 7 29776437 missense probably benign 0.00
R8138:Zfp84 UTSW 7 29775372 missense probably damaging 0.99
V3553:Zfp84 UTSW 7 29777247 missense probably benign 0.36
Z1186:Zfp84 UTSW 7 29771380 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCCTTTAACAAGAGTGCCAAC -3'
(R):5'- TCCTCTGGTGCAGAATGAGAG -3'

Sequencing Primer
(F):5'- TTTAACAAGAGTGCCAACCTCACTAG -3'
(R):5'- ATAAGGCCTCTCTCCAGTGTGAATC -3'
Posted On2016-10-06