Incidental Mutation 'R5474:Polb'
ID433974
Institutional Source Beutler Lab
Gene Symbol Polb
Ensembl Gene ENSMUSG00000031536
Gene Namepolymerase (DNA directed), beta
SynonymsPol beta, A430088C08Rik
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22628126-22653435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22630370 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 296 (Y296H)
Ref Sequence ENSEMBL: ENSMUSP00000033938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033936] [ENSMUST00000033938]
Predicted Effect probably benign
Transcript: ENSMUST00000033936
SMART Domains Protein: ENSMUSP00000033936
Gene: ENSMUSG00000031535

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Dickkopf_N 40 91 2e-18 PFAM
Pfam:Prokineticin 135 213 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033938
AA Change: Y296H

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033938
Gene: ENSMUSG00000031536
AA Change: Y296H

DomainStartEndE-ValueType
POLXc 10 334 4.58e-159 SMART
HhH1 57 76 1.91e-1 SMART
HhH1 98 117 1.14e1 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for one knock-out allele die from E10.5 to birth and those for another one exhibit embryonic growth retardation, abnormal neurogenesis, and neonatal lethality due to respiratory failure. Hypomorphic allele mice develop systemic lupus erythematosus-like phentoypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Polb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Polb APN 8 22653072 missense probably damaging 1.00
IGL02421:Polb APN 8 22640373 missense probably damaging 1.00
IGL02618:Polb APN 8 22637093 missense probably damaging 1.00
IGL02850:Polb APN 8 22648261 splice site probably benign
IGL03143:Polb APN 8 22640351 splice site probably benign
IGL02796:Polb UTSW 8 22631458 missense probably damaging 1.00
R0280:Polb UTSW 8 22640392 missense probably damaging 0.99
R0383:Polb UTSW 8 22639995 nonsense probably null
R0788:Polb UTSW 8 22642338 missense probably null
R1374:Polb UTSW 8 22653057 splice site probably benign
R1564:Polb UTSW 8 22630341 critical splice donor site probably null
R2194:Polb UTSW 8 22647467 missense probably benign 0.05
R2295:Polb UTSW 8 22653319 missense probably damaging 1.00
R2314:Polb UTSW 8 22640002 missense possibly damaging 0.69
R4992:Polb UTSW 8 22645071 missense probably damaging 0.97
R5107:Polb UTSW 8 22645046 splice site probably null
R5905:Polb UTSW 8 22639995 nonsense probably null
R5908:Polb UTSW 8 22642303 critical splice donor site probably null
R6028:Polb UTSW 8 22639995 nonsense probably null
R6188:Polb UTSW 8 22647447 missense probably damaging 0.99
R7304:Polb UTSW 8 22639959 missense probably benign
R7644:Polb UTSW 8 22640427 missense probably benign 0.02
R7766:Polb UTSW 8 22653091 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTGGTGTTTAAAACCATAAAGAAGC -3'
(R):5'- GACATACCTCAGTGTTTTGTCTAC -3'

Sequencing Primer
(F):5'- ACAGGTTCAGAGGTTCAGTCC -3'
(R):5'- GGTTGATCCCCAAAGATCA -3'
Posted On2016-10-06