Incidental Mutation 'R5474:Ptprk'
ID433979
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 28496930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 726 (R726*)
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably null
Transcript: ENSMUST00000166468
AA Change: R726*
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: R726*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218276
AA Change: R726*
Predicted Effect probably null
Transcript: ENSMUST00000218359
AA Change: R726*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CCTGCCATACCTAAGCTTGC -3'
(R):5'- ACACTGCATGTAATAGGTCTGAAAC -3'

Sequencing Primer
(F):5'- CCTAAGCTTGCTTTATTACCAAGTG -3'
(R):5'- GCATGTAATAGGTCTGAAACAATGAC -3'
Posted On2016-10-06