Incidental Mutation 'R5474:Krt14'
ID433983
Institutional Source Beutler Lab
Gene Symbol Krt14
Ensembl Gene ENSMUSG00000045545
Gene Namekeratin 14
SynonymsKrt1-14, K14, Cytokeratin 14, Krt-1.14, epidermolysis bullosa simplex, Dowling-Meara, Koebner
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100203162-100207548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100204745 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 278 (M278K)
Ref Sequence ENSEMBL: ENSMUSP00000007272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007272]
Predicted Effect probably damaging
Transcript: ENSMUST00000007272
AA Change: M278K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007272
Gene: ENSMUSG00000045545
AA Change: M278K

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 120 431 5.67e-176 SMART
low complexity region 433 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137265
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations develop extensive skin blistering after birth and die by 2 days of age. If keratin 16 is also expressed in skin, development is normal but later alopecia, chronic skin ulcers and stratified epithelial defects occur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Krt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Krt14 APN 11 100204416 splice site probably benign
R0449:Krt14 UTSW 11 100207395 missense unknown
R0848:Krt14 UTSW 11 100204264 missense probably damaging 1.00
R1302:Krt14 UTSW 11 100203347 missense probably damaging 1.00
R2024:Krt14 UTSW 11 100207218 missense unknown
R2088:Krt14 UTSW 11 100204123 missense possibly damaging 0.81
R2161:Krt14 UTSW 11 100207113 missense unknown
R3878:Krt14 UTSW 11 100207089 missense possibly damaging 0.56
R5015:Krt14 UTSW 11 100207206 nonsense probably null
R5314:Krt14 UTSW 11 100204700 missense probably damaging 1.00
R5698:Krt14 UTSW 11 100205625 missense probably benign 0.44
R5707:Krt14 UTSW 11 100204758 missense possibly damaging 0.77
R6072:Krt14 UTSW 11 100207166 missense unknown
R6523:Krt14 UTSW 11 100205097 missense possibly damaging 0.81
R6622:Krt14 UTSW 11 100203960 missense probably benign 0.00
R7082:Krt14 UTSW 11 100203341 missense possibly damaging 0.95
R7239:Krt14 UTSW 11 100204255 missense probably benign 0.03
R7350:Krt14 UTSW 11 100205100 nonsense probably null
X0020:Krt14 UTSW 11 100205106 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACTAGAAAGCCCTGGAAGG -3'
(R):5'- CTGGCCTACCTGAAGAAGAACC -3'

Sequencing Primer
(F):5'- CCTGGAAGGCAGGTACTCTG -3'
(R):5'- CCAGCTTAAGAGGGTGGATG -3'
Posted On2016-10-06