Incidental Mutation 'R5474:2700081O15Rik'
ID433993
Institutional Source Beutler Lab
Gene Symbol 2700081O15Rik
Ensembl Gene ENSMUSG00000053080
Gene NameRIKEN cDNA 2700081O15 gene
Synonyms
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7417625-7425904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7420159 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 24 (R24W)
Ref Sequence ENSEMBL: ENSMUSP00000139847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159348] [ENSMUST00000161907]
Predicted Effect probably benign
Transcript: ENSMUST00000159346
SMART Domains Protein: ENSMUSP00000124442
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
low complexity region 42 67 N/A INTRINSIC
low complexity region 72 97 N/A INTRINSIC
low complexity region 178 215 N/A INTRINSIC
ZnF_C2H2 231 256 2.06e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159348
AA Change: R78W
SMART Domains Protein: ENSMUSP00000123773
Gene: ENSMUSG00000053080
AA Change: R78W

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
ZnF_C2H2 124 149 3.38e1 SMART
low complexity region 171 201 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 235 260 N/A INTRINSIC
ZnF_C2H2 283 308 1.06e2 SMART
low complexity region 382 419 N/A INTRINSIC
ZnF_C2H2 435 460 2.06e1 SMART
low complexity region 491 522 N/A INTRINSIC
low complexity region 540 547 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
ZnF_C2H2 600 625 2.54e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160561
SMART Domains Protein: ENSMUSP00000124645
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
ZnF_C2H2 10 35 1.06e2 SMART
low complexity region 109 146 N/A INTRINSIC
ZnF_C2H2 162 187 2.06e1 SMART
low complexity region 218 249 N/A INTRINSIC
low complexity region 267 274 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
ZnF_C2H2 327 352 2.54e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161907
AA Change: R24W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139847
Gene: ENSMUSG00000053080
AA Change: R24W

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
ZnF_C2H2 70 95 1.4e-1 SMART
coiled coil region 124 151 N/A INTRINSIC
low complexity region 173 180 N/A INTRINSIC
low complexity region 190 205 N/A INTRINSIC
ZnF_C2H2 233 258 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189779
Predicted Effect probably benign
Transcript: ENSMUST00000191580
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in 2700081O15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02376:2700081O15Rik APN 19 7422376 missense probably damaging 1.00
IGL02814:2700081O15Rik APN 19 7420422 missense possibly damaging 0.94
H8562:2700081O15Rik UTSW 19 7422921 missense probably benign 0.01
R0034:2700081O15Rik UTSW 19 7420359 missense probably damaging 1.00
R0583:2700081O15Rik UTSW 19 7420274 missense probably damaging 1.00
R2351:2700081O15Rik UTSW 19 7422244 missense probably damaging 1.00
R4326:2700081O15Rik UTSW 19 7421226 intron probably benign
R4329:2700081O15Rik UTSW 19 7421226 intron probably benign
R5735:2700081O15Rik UTSW 19 7422796 missense probably benign
R6168:2700081O15Rik UTSW 19 7422940 missense probably benign 0.40
R6739:2700081O15Rik UTSW 19 7421347 nonsense probably null
R7780:2700081O15Rik UTSW 19 7422372 missense probably damaging 0.96
R7855:2700081O15Rik UTSW 19 7422256 missense probably damaging 1.00
R8550:2700081O15Rik UTSW 19 7422955 missense probably benign 0.00
Z1176:2700081O15Rik UTSW 19 7422747 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTCAGCAAGCTAGCCCAG -3'
(R):5'- GCGAATGTGCCTCTTGATGG -3'

Sequencing Primer
(F):5'- AAGCTAGCCCAGTGCCC -3'
(R):5'- CCTCTTGATGGTGCTGAGC -3'
Posted On2016-10-06