Incidental Mutation 'R5475:Cacna1e'
ID433999
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Namecalcium channel, voltage-dependent, R type, alpha 1E subunit
SynonymsCchra1, alpha1E, Cav2.3
MMRRC Submission 043036-MU
Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location154390731-154884501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154725709 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 71 (F71I)
Ref Sequence ENSEMBL: ENSMUSP00000140937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
Predicted Effect probably benign
Transcript: ENSMUST00000004214
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187541
AA Change: F71I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: F71I

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188965
Predicted Effect probably benign
Transcript: ENSMUST00000211821
Meta Mutation Damage Score 0.8648 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154403683 missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154471601 missense probably benign 0.04
IGL01302:Cacna1e APN 1 154443907 missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154472377 missense probably benign 0.18
IGL01573:Cacna1e APN 1 154471367 missense probably benign
IGL01676:Cacna1e APN 1 154398476 missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154412450 missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154471373 missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154471340 missense probably null 0.00
IGL01895:Cacna1e APN 1 154443900 missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154421113 missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154403747 missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154426528 missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154493409 missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154445648 missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154465741 missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154471425 missense probably benign 0.15
IGL03120:Cacna1e APN 1 154443881 missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154493358 missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154442251 missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154466944 critical splice donor site probably null
bezoar UTSW 1 154436554 splice site probably null
hairball UTSW 1 154479305 missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154443901 missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154448947 splice site probably null
R0314:Cacna1e UTSW 1 154442251 missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154416138 missense probably benign 0.03
R0626:Cacna1e UTSW 1 154488817 missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154442278 missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154444968 missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154398673 missense probably benign
R1340:Cacna1e UTSW 1 154472657 missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154561806 missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154485662 critical splice donor site probably null
R1538:Cacna1e UTSW 1 154561758 missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154477779 missense probably benign 0.01
R1560:Cacna1e UTSW 1 154421104 nonsense probably null
R1748:Cacna1e UTSW 1 154486569 missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154444000 missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154436449 missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154700494 missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154443845 missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154403683 missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154472193 missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154416085 missense probably benign 0.08
R3757:Cacna1e UTSW 1 154633696 missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154483553 missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154482585 missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154412183 splice site probably null
R4275:Cacna1e UTSW 1 154493325 missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154426550 missense probably benign 0.04
R4297:Cacna1e UTSW 1 154398731 missense probably benign 0.37
R4356:Cacna1e UTSW 1 154443981 missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154402027 missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154436519 missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154471613 missense probably benign
R4622:Cacna1e UTSW 1 154471565 missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154482548 splice site probably null
R4694:Cacna1e UTSW 1 154437266 critical splice donor site probably null
R4727:Cacna1e UTSW 1 154436468 nonsense probably null
R4839:Cacna1e UTSW 1 154421058 missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154436554 splice site probably null
R4894:Cacna1e UTSW 1 154488805 nonsense probably null
R4934:Cacna1e UTSW 1 154481634 nonsense probably null
R4979:Cacna1e UTSW 1 154413993 missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154561729 critical splice donor site probably null
R5128:Cacna1e UTSW 1 154402021 missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154701364 missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154700504 missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154477796 missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154465779 missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154443937 missense probably damaging 1.00
R5607:Cacna1e UTSW 1 154471340 missense probably benign 0.00
R5615:Cacna1e UTSW 1 154412170 missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154442194 missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154635858 missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154633717 missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154471637 missense probably benign 0.00
R5893:Cacna1e UTSW 1 154437323 missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154561791 missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154701291 missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154486570 missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6295:Cacna1e UTSW 1 154442173 missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6320:Cacna1e UTSW 1 154441524 missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154479305 missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154413974 critical splice donor site probably null
R6842:Cacna1e UTSW 1 154483117 missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154725693 missense probably null 0.85
R7081:Cacna1e UTSW 1 154700383 missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154473746 splice site probably null
R7108:Cacna1e UTSW 1 154468995 frame shift probably null
R7142:Cacna1e UTSW 1 154412484 missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154700489 missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154725801 missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154472234 missense probably benign 0.13
R7502:Cacna1e UTSW 1 154468988 missense probably null 0.35
R7556:Cacna1e UTSW 1 154472673 missense probably benign 0.28
R7563:Cacna1e UTSW 1 154471416 missense probably benign 0.00
R7573:Cacna1e UTSW 1 154726165 intron probably benign
R7689:Cacna1e UTSW 1 154398803 missense probably benign 0.01
R7699:Cacna1e UTSW 1 154443928 missense probably damaging 1.00
R7744:Cacna1e UTSW 1 154465792 missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154413117 missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154482568 missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154398406 missense probably damaging 1.00
R7838:Cacna1e UTSW 1 154471403 missense probably benign 0.08
R7849:Cacna1e UTSW 1 154633718 missense probably damaging 1.00
R8011:Cacna1e UTSW 1 154465822 missense probably benign 0.01
R8094:Cacna1e UTSW 1 154561770 missense probably damaging 1.00
R8162:Cacna1e UTSW 1 154701567 splice site probably null
R8202:Cacna1e UTSW 1 154398449 missense probably benign
R8280:Cacna1e UTSW 1 154469093 missense probably damaging 0.97
R8354:Cacna1e UTSW 1 154398568 missense probably damaging 1.00
R8385:Cacna1e UTSW 1 154443941 missense probably damaging 0.98
R8532:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R8902:Cacna1e UTSW 1 154473886 missense probably benign 0.01
R8926:Cacna1e UTSW 1 154701334 missense possibly damaging 0.84
R8947:Cacna1e UTSW 1 154402150 missense probably benign 0.10
RF008:Cacna1e UTSW 1 154442136 missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154412492 missense probably damaging 1.00
Z1176:Cacna1e UTSW 1 154635850 missense probably damaging 0.98
Z1177:Cacna1e UTSW 1 154442292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGCAAAGGGGCAAATTTTG -3'
(R):5'- AACTTCAGGATGGCTCGCTTC -3'

Sequencing Primer
(F):5'- TTTTGGCACCAGGAAGGG -3'
(R):5'- GTGGTCGTTGGCAGGCC -3'
Posted On2016-10-06