Mutagenetix > Incidental Mutation

Incidental Mutation 'R5475:Cse1l'

434003

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

043036-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5475 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 166941254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 684 (S684P)

Ref Sequence

ENSEMBL: ENSMUSP00000129983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably damaging
Transcript: ENSMUST00000002790
AA Change: S740P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: S740P

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145819

Predicted Effect

probably damaging
Transcript: ENSMUST00000163437
AA Change: S427P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: S427P

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163917

Predicted Effect

probably benign
Transcript: ENSMUST00000164974

SMART Domains

Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:CAS_CSE1	24	72	5.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166871

Predicted Effect

probably damaging
Transcript: ENSMUST00000168599
AA Change: S684P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: S684P

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169290

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172037

Meta Mutation Damage Score

0.8533

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.5%
20x: 91.8%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	A	T	16: 13,677,113	R25S	possibly damaging	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
AA467197	A	G	2: 122,640,726	K70R	probably damaging	Het
Agr3	A	G	12: 35,947,540	N83S	probably benign	Het
Alpk2	T	C	18: 65,307,012	T904A	probably benign	Het
Ank	A	T	15: 27,557,199	K156N	probably damaging	Het
Arsb	T	G	13: 93,862,265	D360E	probably benign	Het
Atg14	C	T	14: 47,568,336	R24Q	possibly damaging	Het
Cacna1e	A	T	1: 154,725,709	F71I	possibly damaging	Het
Cdc42bpg	T	C	19: 6,311,071	I242T	probably damaging	Het
Cngb1	A	T	8: 95,251,969	I588N	probably damaging	Het
Col6a6	T	C	9: 105,774,338	H1158R	probably null	Het
Cyp2c29	A	T	19: 39,330,287	M404L	possibly damaging	Het
D5Ertd579e	G	T	5: 36,615,257	S598Y	probably damaging	Het
Dph7	A	T	2: 24,968,957		probably null	Het
Dsg1c	A	T	18: 20,282,031	N662Y	probably damaging	Het
Efcab9	T	G	11: 32,522,862	D195A	probably damaging	Het
Ephb4	A	G	5: 137,354,439	M95V	probably benign	Het
Fam171a1	A	T	2: 3,225,297	Y489F	possibly damaging	Het
Fars2	T	C	13: 36,204,570	I14T	probably benign	Het
Fbxo34	T	C	14: 47,529,345	V54A	probably benign	Het
Fbxw17	T	C	13: 50,425,648	I167T	probably benign	Het
Fzd9	A	T	5: 135,250,269		probably null	Het
Gm26996	T	A	6: 130,579,955		noncoding transcript	Het
Gm4744	A	G	6: 40,950,454		probably benign	Het
Gm4744	T	A	6: 40,950,469		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
H2-Ke6	C	T	17: 34,027,313		probably benign	Het
Has1	C	A	17: 17,848,321	R257L	possibly damaging	Het
Hfe2	T	C	3: 96,527,283	S113P	probably benign	Het
Kat2b	T	G	17: 53,663,581	V665G	probably damaging	Het
Klhdc4	T	A	8: 121,799,572	H276L	possibly damaging	Het
Klhl6	A	T	16: 19,948,127	C506S	probably damaging	Het
Ldb2	T	C	5: 44,541,832	Y88C	probably damaging	Het
Lrit1	A	G	14: 37,055,001	E26G	probably benign	Het
Mcoln2	A	G	3: 146,183,786	Y414C	probably damaging	Het
Mfsd5	A	G	15: 102,280,493	D100G	probably damaging	Het
Micall2	T	A	5: 139,716,469	S340C	probably damaging	Het
Npsr1	T	C	9: 24,300,419	I81T	probably damaging	Het
Olfr1344	G	T	7: 6,440,170	R90L	probably benign	Het
Olfr331	A	G	11: 58,501,605	V317A	probably benign	Het
Olfr923	T	A	9: 38,828,466	F258L	possibly damaging	Het
Olfr986	T	A	9: 40,187,709	L198H	possibly damaging	Het
Pax3	T	C	1: 78,103,418	T444A	probably benign	Het
Pea15a	A	G	1: 172,199,242		probably null	Het
Phc1	T	A	6: 122,334,092	Q95L	possibly damaging	Het
Plch2	T	C	4: 155,000,137	Y361C	probably damaging	Het
Rad54l2	C	T	9: 106,705,858	G787D	probably damaging	Het
Rbm20	G	T	19: 53,834,705	E578*	probably null	Het
Sipa1l2	A	T	8: 125,491,595	D334E	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thumpd1	A	G	7: 119,720,720	S8P	probably benign	Het
Tnxb	T	C	17: 34,689,593	Y1407H	probably damaging	Het
Trav2	T	A	14: 52,567,833	V37E	probably damaging	Het
Trav3-1	G	T	14: 52,581,037	W56L	probably damaging	Het
Usp31	A	T	7: 121,651,526	L808Q	probably damaging	Het
Vmn1r52	C	T	6: 90,178,912	A66V	probably benign	Het
Vmn2r105	T	A	17: 20,234,782	I31L	probably benign	Het
Wdr1	C	T	5: 38,529,588	G278S	probably damaging	Het
Zbtb2	G	T	10: 4,369,275	F250L	probably benign	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTATGTGTCTGATACTCAGTC -3'
(R):5'- ACTCTTGATAAACTTGGTGGTCTTG -3'

Sequencing Primer
(F):5'- GTGTCTGATACTCAGTCCACCACAC -3'
(R):5'- AAGATCTGCTTCCTATACTGGTCAAC -3'

Posted On

2016-10-06