Incidental Mutation 'R5475:Mcoln2'
ID434005
Institutional Source Beutler Lab
Gene Symbol Mcoln2
Ensembl Gene ENSMUSG00000011008
Gene Namemucolipin 2
Synonymsmucolipidin 2, TRPML2, 3300002C04Rik
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5475 (G1)
Quality Score193
Status Validated
Chromosome3
Chromosomal Location146149833-146195513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146183786 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 414 (Y414C)
Ref Sequence ENSEMBL: ENSMUSP00000096125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011152] [ENSMUST00000098524]
Predicted Effect probably damaging
Transcript: ENSMUST00000011152
AA Change: Y442C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011152
Gene: ENSMUSG00000011008
AA Change: Y442C

DomainStartEndE-ValueType
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 340 362 N/A INTRINSIC
Pfam:PKD_channel 370 513 5.8e-12 PFAM
low complexity region 546 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098524
AA Change: Y414C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096125
Gene: ENSMUSG00000011008
AA Change: Y414C

DomainStartEndE-ValueType
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Pfam:PKD_channel 343 485 6.9e-11 PFAM
low complexity region 518 530 N/A INTRINSIC
Meta Mutation Damage Score 0.8016 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6-membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced chemokine production in bone marrow-derived macrophages and impaired recruitment of peripheral macrophages in response to i.p. injections of LPS or live bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Mcoln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mcoln2 APN 3 146163527 splice site probably benign
IGL01370:Mcoln2 APN 3 146181830 missense possibly damaging 0.71
IGL01479:Mcoln2 APN 3 146175652 splice site probably benign
IGL02629:Mcoln2 APN 3 146170044 missense probably benign 0.28
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0109:Mcoln2 UTSW 3 146175718 missense probably damaging 1.00
R0458:Mcoln2 UTSW 3 146150013 unclassified probably benign
R1335:Mcoln2 UTSW 3 146180174 missense probably benign 0.00
R1440:Mcoln2 UTSW 3 146190382 nonsense probably null
R1452:Mcoln2 UTSW 3 146181814 missense possibly damaging 0.92
R1459:Mcoln2 UTSW 3 146192224 splice site probably null
R1510:Mcoln2 UTSW 3 146176610 missense probably benign 0.02
R1603:Mcoln2 UTSW 3 146180222 missense probably damaging 1.00
R1652:Mcoln2 UTSW 3 146163635 missense possibly damaging 0.48
R1718:Mcoln2 UTSW 3 146190474 splice site probably benign
R1826:Mcoln2 UTSW 3 146175472 missense possibly damaging 0.69
R4319:Mcoln2 UTSW 3 146150011 splice site probably null
R4719:Mcoln2 UTSW 3 146175713 missense probably benign 0.00
R4939:Mcoln2 UTSW 3 146192241 missense probably benign 0.07
R5718:Mcoln2 UTSW 3 146181826 missense probably damaging 1.00
R5906:Mcoln2 UTSW 3 146183741 missense probably damaging 1.00
R6911:Mcoln2 UTSW 3 146192256 missense probably damaging 1.00
R6963:Mcoln2 UTSW 3 146172035 missense probably damaging 1.00
R7142:Mcoln2 UTSW 3 146183569 critical splice donor site probably null
R7613:Mcoln2 UTSW 3 146175544 splice site probably null
R8076:Mcoln2 UTSW 3 146190414 missense probably damaging 1.00
R8077:Mcoln2 UTSW 3 146190414 missense probably damaging 1.00
R8271:Mcoln2 UTSW 3 146192424 missense unknown
Z1177:Mcoln2 UTSW 3 146175704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTTCTGCCAGCTGGTTC -3'
(R):5'- TGAATGTGTCAGATCCTCAGCC -3'

Sequencing Primer
(F):5'- GTTCTCATCCTCCGAGACGAG -3'
(R):5'- CCTGGCTCAGACTACTATGAGAG -3'
Posted On2016-10-06