Incidental Mutation 'R5475:Tbc1d2'
ID434006
Institutional Source Beutler Lab
Gene Symbol Tbc1d2
Ensembl Gene ENSMUSG00000039813
Gene NameTBC1 domain family, member 2
SynonymsPARIS-1, A630005A06Rik, LOC381605, PARIS1
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5475 (G1)
Quality Score97
Status Validated
Chromosome4
Chromosomal Location46604390-46650209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46629912 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 252 (G252R)
Ref Sequence ENSEMBL: ENSMUSP00000081670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084621] [ENSMUST00000107750]
Predicted Effect probably benign
Transcript: ENSMUST00000084621
AA Change: G252R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081670
Gene: ENSMUSG00000039813
AA Change: G252R

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
coiled coil region 362 394 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
Blast:TBC 454 491 3e-14 BLAST
low complexity region 526 539 N/A INTRINSIC
Blast:TBC 557 591 3e-10 BLAST
TBC 616 834 1.63e-60 SMART
coiled coil region 869 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107750
SMART Domains Protein: ENSMUSP00000103379
Gene: ENSMUSG00000039813

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Tbc1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Tbc1d2 APN 4 46649745 missense probably benign 0.04
IGL01748:Tbc1d2 APN 4 46616306 missense probably damaging 0.99
IGL01863:Tbc1d2 APN 4 46607064 missense possibly damaging 0.66
IGL02014:Tbc1d2 APN 4 46649778 missense possibly damaging 0.83
IGL02025:Tbc1d2 APN 4 46620713 missense probably damaging 1.00
IGL02551:Tbc1d2 APN 4 46649916 missense probably benign
IGL02571:Tbc1d2 APN 4 46628370 missense probably benign 0.00
IGL03149:Tbc1d2 APN 4 46637619 missense probably benign 0.31
R0347:Tbc1d2 UTSW 4 46620574 missense possibly damaging 0.82
R0374:Tbc1d2 UTSW 4 46649913 missense possibly damaging 0.95
R0522:Tbc1d2 UTSW 4 46649806 missense probably damaging 1.00
R0883:Tbc1d2 UTSW 4 46609003 nonsense probably null
R1227:Tbc1d2 UTSW 4 46620629 missense probably benign 0.00
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1658:Tbc1d2 UTSW 4 46614207 missense probably damaging 1.00
R1959:Tbc1d2 UTSW 4 46606419 missense probably benign 0.44
R2108:Tbc1d2 UTSW 4 46637652 missense possibly damaging 0.62
R3864:Tbc1d2 UTSW 4 46620484 missense probably benign 0.01
R4475:Tbc1d2 UTSW 4 46609080 missense possibly damaging 0.92
R5112:Tbc1d2 UTSW 4 46606503 missense probably damaging 1.00
R5127:Tbc1d2 UTSW 4 46633639 intron probably benign
R5215:Tbc1d2 UTSW 4 46614006 missense probably benign 0.42
R5550:Tbc1d2 UTSW 4 46646138 missense probably benign 0.00
R5558:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5564:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5599:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5600:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5699:Tbc1d2 UTSW 4 46616298 missense probably benign 0.31
R5866:Tbc1d2 UTSW 4 46637715 missense possibly damaging 0.80
R5909:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5911:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5980:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6194:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6195:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6209:Tbc1d2 UTSW 4 46614068 missense probably damaging 1.00
R6211:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6232:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6242:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6261:Tbc1d2 UTSW 4 46637692 missense possibly damaging 0.47
R6273:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6274:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6285:Tbc1d2 UTSW 4 46615045 missense possibly damaging 0.49
R6333:Tbc1d2 UTSW 4 46620736 missense possibly damaging 0.64
R6369:Tbc1d2 UTSW 4 46614420 missense probably benign 0.41
R6912:Tbc1d2 UTSW 4 46649712 missense probably damaging 1.00
R7428:Tbc1d2 UTSW 4 46649965 missense probably benign 0.02
R7775:Tbc1d2 UTSW 4 46637746 splice site probably null
R7824:Tbc1d2 UTSW 4 46637746 splice site probably null
R8069:Tbc1d2 UTSW 4 46649737 missense possibly damaging 0.81
R8135:Tbc1d2 UTSW 4 46609071 missense probably benign 0.31
R8203:Tbc1d2 UTSW 4 46606476 missense probably damaging 1.00
R8271:Tbc1d2 UTSW 4 46649791 missense possibly damaging 0.88
X0023:Tbc1d2 UTSW 4 46615037 missense probably benign 0.00
X0063:Tbc1d2 UTSW 4 46606492 missense probably damaging 1.00
Z1177:Tbc1d2 UTSW 4 46650016 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGAGTCAGCCTGGGTG -3'
(R):5'- CTGAGGCCAGAGCTCTGCA -3'

Sequencing Primer
(F):5'- CAGCCCCATGATAGGATTAGTGTC -3'
(R):5'- AGAGCTCTGCAGGCAGC -3'
Posted On2016-10-06