Incidental Mutation 'R5475:Wdr1'
ID434009
Institutional Source Beutler Lab
Gene Symbol Wdr1
Ensembl Gene ENSMUSG00000005103
Gene NameWD repeat domain 1
SynonymsAip1, rede, D5Wsu185e
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38526813-38563221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38529588 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 278 (G278S)
Ref Sequence ENSEMBL: ENSMUSP00000143937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005234] [ENSMUST00000201260]
Predicted Effect probably damaging
Transcript: ENSMUST00000005234
AA Change: G551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005234
Gene: ENSMUSG00000005103
AA Change: G551S

DomainStartEndE-ValueType
WD40 47 86 1.7e-2 SMART
WD40 91 134 5.52e0 SMART
WD40 135 175 3.69e-3 SMART
WD40 178 217 4.4e-10 SMART
WD40 220 262 1.74e-8 SMART
WD40 309 350 7.05e-9 SMART
WD40 354 392 6.9e-1 SMART
WD40 434 473 1.36e-1 SMART
WD40 478 517 7.8e-2 SMART
WD40 521 560 1.83e-7 SMART
WD40 564 603 3.71e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201059
Predicted Effect probably damaging
Transcript: ENSMUST00000201260
AA Change: G278S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143937
Gene: ENSMUSG00000005103
AA Change: G278S

DomainStartEndE-ValueType
WD40 36 77 4.6e-11 SMART
WD40 81 119 4.5e-3 SMART
WD40 161 200 8.9e-4 SMART
WD40 205 244 4.9e-4 SMART
WD40 248 287 1.2e-9 SMART
WD40 291 330 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202496
Meta Mutation Damage Score 0.4249 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Severe loss of function at this locus causes embryonic lethality. Mice homozygous for a hypomorphic ENU-induced allele exhibit thrombocytopenia due to impaired megakaryocyte maturation and platelet shedding, and develop autoinflammatory disease associated with defects in neutrophil function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Wdr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Wdr1 APN 5 38535323 missense probably benign 0.00
IGL01071:Wdr1 APN 5 38530067 missense probably benign 0.14
IGL01293:Wdr1 APN 5 38529543 missense probably benign 0.00
IGL01347:Wdr1 APN 5 38545715 missense possibly damaging 0.77
IGL01532:Wdr1 APN 5 38535187 missense probably damaging 1.00
IGL02409:Wdr1 APN 5 38531110 missense probably benign 0.06
IGL02415:Wdr1 APN 5 38531110 missense probably damaging 1.00
IGL02543:Wdr1 APN 5 38545822 missense probably damaging 1.00
IGL02550:Wdr1 APN 5 38540863 missense probably damaging 1.00
IGL03093:Wdr1 APN 5 38561129 missense probably benign 0.01
IGL03183:Wdr1 APN 5 38533482 critical splice donor site probably null
R0724:Wdr1 UTSW 5 38540862 missense possibly damaging 0.87
R1509:Wdr1 UTSW 5 38540562 missense probably damaging 0.96
R1589:Wdr1 UTSW 5 38529972 missense probably benign 0.43
R3039:Wdr1 UTSW 5 38530085 missense possibly damaging 0.94
R3767:Wdr1 UTSW 5 38540539 missense probably damaging 1.00
R4833:Wdr1 UTSW 5 38547029 missense probably damaging 1.00
R5405:Wdr1 UTSW 5 38535200 missense probably benign 0.03
R5476:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5619:Wdr1 UTSW 5 38529536 missense possibly damaging 0.93
R5852:Wdr1 UTSW 5 38537175 missense probably benign 0.00
R5876:Wdr1 UTSW 5 38530023 missense probably benign 0.01
R6170:Wdr1 UTSW 5 38529671 critical splice acceptor site probably null
R6367:Wdr1 UTSW 5 38545846 missense possibly damaging 0.68
R6524:Wdr1 UTSW 5 38530063 missense probably benign 0.07
R6643:Wdr1 UTSW 5 38540178 missense probably damaging 1.00
R6838:Wdr1 UTSW 5 38530031 missense probably damaging 0.96
R7305:Wdr1 UTSW 5 38540092 missense possibly damaging 0.90
R8364:Wdr1 UTSW 5 38527849 missense possibly damaging 0.80
R8380:Wdr1 UTSW 5 38540521 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AATGTCTCAGGGTTCCTCTGC -3'
(R):5'- TGTTACTTCAAGGGCTGGC -3'

Sequencing Primer
(F):5'- TGGAGCCACATTTCATCAGG -3'
(R):5'- CTGGCTGGGAGGACACATG -3'
Posted On2016-10-06