Incidental Mutation 'R5475:Micall2'
ID434013
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene NameMICAL-like 2
SynonymsA930021H16Rik, Jrab, MICAL-L2
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139706696-139736336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139716469 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 340 (S340C)
Ref Sequence ENSEMBL: ENSMUSP00000039707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
Predicted Effect probably damaging
Transcript: ENSMUST00000044642
AA Change: S340C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: S340C

DomainStartEndE-ValueType
CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165645
Predicted Effect unknown
Transcript: ENSMUST00000170773
AA Change: S257C
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: S257C

DomainStartEndE-ValueType
SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139717556 critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139716328 missense probably benign 0.01
IGL02641:Micall2 APN 5 139719339 missense probably damaging 1.00
IGL03245:Micall2 APN 5 139719259 missense probably damaging 1.00
IGL03252:Micall2 APN 5 139716726 missense probably benign 0.01
R1214:Micall2 UTSW 5 139711641 missense probably damaging 0.97
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1831:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1833:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1969:Micall2 UTSW 5 139736130 missense probably damaging 1.00
R2023:Micall2 UTSW 5 139717511 missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139711562 missense probably damaging 0.98
R2330:Micall2 UTSW 5 139717515 missense probably damaging 1.00
R3820:Micall2 UTSW 5 139715856 missense possibly damaging 0.92
R4299:Micall2 UTSW 5 139709471 intron probably benign
R4334:Micall2 UTSW 5 139713350 missense probably damaging 1.00
R4451:Micall2 UTSW 5 139707097 missense probably damaging 1.00
R4769:Micall2 UTSW 5 139706886 missense probably damaging 0.97
R4911:Micall2 UTSW 5 139716825 missense probably damaging 1.00
R4996:Micall2 UTSW 5 139710589 missense probably benign 0.31
R5118:Micall2 UTSW 5 139716447 missense probably damaging 1.00
R5155:Micall2 UTSW 5 139710231 missense probably damaging 1.00
R5750:Micall2 UTSW 5 139715701 splice site probably null
R5998:Micall2 UTSW 5 139706911 critical splice acceptor site probably null
R6181:Micall2 UTSW 5 139716751 missense probably benign 0.41
R6852:Micall2 UTSW 5 139715793 missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139708944 unclassified probably benign
R7395:Micall2 UTSW 5 139716369 missense possibly damaging 0.78
Z1088:Micall2 UTSW 5 139706894 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139716295 missense probably benign 0.12
Z1177:Micall2 UTSW 5 139710302 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACCGCTGTGTTTGAAGACTC -3'
(R):5'- TCTCATGGACGGTTCAGGAG -3'

Sequencing Primer
(F):5'- AGACTCTGAGTTCAAGTTGAGC -3'
(R):5'- CGGTTCAGGAGGCAAATGG -3'
Posted On2016-10-06