Incidental Mutation 'R5475:Vmn1r52'
ID434016
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Namevomeronasal 1 receptor 52
SynonymsV1ra7, VN3
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5475 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90174808-90181248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90178912 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 66 (A66V)
Ref Sequence ENSEMBL: ENSMUSP00000154275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228385] [ENSMUST00000228394] [ENSMUST00000228665]
Predicted Effect probably benign
Transcript: ENSMUST00000079832
AA Change: A66V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: A66V

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Predicted Effect probably benign
Transcript: ENSMUST00000226520
AA Change: A66V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000227100
Predicted Effect probably benign
Transcript: ENSMUST00000227578
Predicted Effect probably benign
Transcript: ENSMUST00000227893
AA Change: A66V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000228385
Predicted Effect probably benign
Transcript: ENSMUST00000228394
AA Change: A66V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000228665
AA Change: A66V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90178923 missense probably benign
IGL02102:Vmn1r52 APN 6 90179207 missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90179144 nonsense probably null
IGL02938:Vmn1r52 APN 6 90179313 missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90179464 missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90179169 missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90179237 missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90178948 missense possibly damaging 0.63
R5689:Vmn1r52 UTSW 6 90179250 missense possibly damaging 0.95
R5740:Vmn1r52 UTSW 6 90179194 missense probably benign 0.02
R7263:Vmn1r52 UTSW 6 90179553 missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90179623 missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90179136 missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90179257 missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90178760 missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90179469 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTTAGACAGCTACTACGTGCTTC -3'
(R):5'- GCTAAGTGAGAGCTTTGAGGGC -3'

Sequencing Primer
(F):5'- ACGTGCTTCTACCCAGTATAACATG -3'
(R):5'- CTTTGAGGGCAGAGGATGATG -3'
Posted On2016-10-06