Incidental Mutation 'R5475:Olfr1344'
ID434019
Institutional Source Beutler Lab
Gene Symbol Olfr1344
Ensembl Gene ENSMUSG00000090824
Gene Nameolfactory receptor 1344
Synonyms4930415J05Rik, GA_x6K02T2QGBW-3169916-3170881, MOR124-1
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5475 (G1)
Quality Score165
Status Validated
Chromosome7
Chromosomal Location6438688-6442161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6440170 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 90 (R90L)
Ref Sequence ENSEMBL: ENSMUSP00000151666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054781] [ENSMUST00000168341] [ENSMUST00000218906]
Predicted Effect probably benign
Transcript: ENSMUST00000054781
SMART Domains Protein: ENSMUSP00000050428
Gene: ENSMUSG00000045929

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168341
AA Change: R90L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130328
Gene: ENSMUSG00000090824
AA Change: R90L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 224 1.9e-7 PFAM
Pfam:7tm_1 43 295 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218906
AA Change: R90L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Olfr1344
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02217:Olfr1344 APN 7 6440245 missense probably damaging 0.96
IGL02689:Olfr1344 APN 7 6440575 missense possibly damaging 0.95
IGL02935:Olfr1344 APN 7 6440754 missense possibly damaging 0.91
R0100:Olfr1344 UTSW 7 6440400 missense probably damaging 1.00
R0100:Olfr1344 UTSW 7 6440400 missense probably damaging 1.00
R0108:Olfr1344 UTSW 7 6440400 missense probably damaging 1.00
R4041:Olfr1344 UTSW 7 6440689 missense probably damaging 1.00
R4247:Olfr1344 UTSW 7 6438902 utr 5 prime probably benign
R5275:Olfr1344 UTSW 7 6440016 missense probably benign 0.01
R6016:Olfr1344 UTSW 7 6440614 missense probably benign
R6048:Olfr1344 UTSW 7 6440355 missense possibly damaging 0.58
R6541:Olfr1344 UTSW 7 6440493 missense probably benign 0.04
R7945:Olfr1344 UTSW 7 6440355 missense probably benign
R8134:Olfr1344 UTSW 7 6438923 utr 5 prime probably benign
X0060:Olfr1344 UTSW 7 6440075 missense probably damaging 1.00
Z1177:Olfr1344 UTSW 7 6440821 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTGGGCCTCACTTCTTCTAG -3'
(R):5'- CGCATTGGGTACAGAGAGTG -3'

Sequencing Primer
(F):5'- AGCCTACCTCACCACTGTG -3'
(R):5'- AGTGCAAAGCCCAGTGTC -3'
Posted On2016-10-06