Incidental Mutation 'R5475:Npsr1'
ID434025
Institutional Source Beutler Lab
Gene Symbol Npsr1
Ensembl Gene ENSMUSG00000043659
Gene Nameneuropeptide S receptor 1
SynonymsVRR1, PGR14, 9330128H10Rik, Gpr154
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24097996-24316398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24300419 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 81 (I81T)
Ref Sequence ENSEMBL: ENSMUSP00000115126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059650] [ENSMUST00000154644]
Predicted Effect probably damaging
Transcript: ENSMUST00000059650
AA Change: I234T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056432
Gene: ENSMUSG00000043659
AA Change: I234T

DomainStartEndE-ValueType
Pfam:7tm_1 66 330 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154337
Predicted Effect probably damaging
Transcript: ENSMUST00000154644
AA Change: I81T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115126
Gene: ENSMUSG00000043659
AA Change: I81T

DomainStartEndE-ValueType
Pfam:7tm_1 2 177 2.7e-27 PFAM
Meta Mutation Damage Score 0.2640 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased airway resistance when treated with high concentrations of U-46619. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Npsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Npsr1 APN 9 24254693 missense probably damaging 1.00
IGL02505:Npsr1 APN 9 24098282 missense probably benign
IGL03306:Npsr1 APN 9 24313239 missense probably benign 0.41
IGL03350:Npsr1 APN 9 24098309 missense probably benign
R0057:Npsr1 UTSW 9 24300427 missense probably damaging 1.00
R0385:Npsr1 UTSW 9 24313277 missense probably damaging 0.99
R1432:Npsr1 UTSW 9 24310075 missense probably damaging 1.00
R2033:Npsr1 UTSW 9 24313352 missense probably benign
R2323:Npsr1 UTSW 9 24300436 missense probably damaging 1.00
R2851:Npsr1 UTSW 9 24310005 splice site probably benign
R2852:Npsr1 UTSW 9 24310005 splice site probably benign
R4088:Npsr1 UTSW 9 24313769 missense possibly damaging 0.56
R4757:Npsr1 UTSW 9 24134768 missense probably benign 0.00
R4812:Npsr1 UTSW 9 24289956 missense probably damaging 0.98
R5175:Npsr1 UTSW 9 24134815 missense probably benign 0.11
R5568:Npsr1 UTSW 9 24313214 missense probably damaging 1.00
R5722:Npsr1 UTSW 9 24313800 missense probably damaging 1.00
R6778:Npsr1 UTSW 9 24254618 missense possibly damaging 0.96
R6811:Npsr1 UTSW 9 24134809 missense probably benign 0.03
R6931:Npsr1 UTSW 9 24289997 missense probably benign 0.27
R7356:Npsr1 UTSW 9 24098261 missense probably benign 0.29
R7569:Npsr1 UTSW 9 24313730 missense probably benign 0.00
R7908:Npsr1 UTSW 9 24289800 missense probably damaging 1.00
R8287:Npsr1 UTSW 9 24289962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCTTGATCTTCTGACACC -3'
(R):5'- CTCATGGGCAACATTTGGGG -3'

Sequencing Primer
(F):5'- CCTTCAGTATGATCAAGCAGAGCTG -3'
(R):5'- GGGGGTCTATTATTCTATTGTTTGG -3'
Posted On2016-10-06