Incidental Mutation 'R5475:Col6a6'
ID434028
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105774338 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1158 (H1158R)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060896
AA Change: H1158R

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: H1158R

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098441
AA Change: H1158R

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: H1158R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166431
AA Change: H1158R

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: H1158R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Meta Mutation Damage Score 0.1481 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- AAATTCTCTCCAACGAGCCG -3'
(R):5'- AAGTATTACTTTCAGCCAGACATGG -3'

Sequencing Primer
(F):5'- gggggAAGTAAACAGTCA -3'
(R):5'- GCAGGATCAACGCAGGTACC -3'
Posted On2016-10-06