Incidental Mutation 'R5475:Rad54l2'
ID434029
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106705858 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 787 (G787D)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect probably damaging
Transcript: ENSMUST00000046502
AA Change: G787D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: G787D

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 splice site probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106719641 missense probably benign 0.00
R8084:Rad54l2 UTSW 9 106713502 missense possibly damaging 0.63
R8552:Rad54l2 UTSW 9 106693578 missense possibly damaging 0.77
R8768:Rad54l2 UTSW 9 106719610 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACAACTTCTCCTGGGGTTTCC -3'
(R):5'- TTTCACAGTGCTGATGTCTAGG -3'

Sequencing Primer
(F):5'- GGGTTTCCTTTCTGACCTCGAAAAAC -3'
(R):5'- CCAGCTCTGAGGGAATCTGATATC -3'
Posted On2016-10-06