Incidental Mutation 'R5475:Lrit1'
ID434039
Institutional Source Beutler Lab
Gene Symbol Lrit1
Ensembl Gene ENSMUSG00000041044
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 1
SynonymsLrrc21
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5475 (G1)
Quality Score223
Status Validated
Chromosome14
Chromosomal Location37054830-37064946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37055001 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 26 (E26G)
Ref Sequence ENSEMBL: ENSMUSP00000113964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120052]
Predicted Effect probably benign
Transcript: ENSMUST00000120052
AA Change: E26G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044
AA Change: E26G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic communication of cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Lrit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Lrit1 APN 14 37060155 missense probably damaging 0.98
IGL01676:Lrit1 APN 14 37057437 missense probably damaging 1.00
IGL02011:Lrit1 APN 14 37062323 missense probably damaging 1.00
PIT4142001:Lrit1 UTSW 14 37062041 missense probably damaging 1.00
R0194:Lrit1 UTSW 14 37061720 missense probably damaging 1.00
R0348:Lrit1 UTSW 14 37060225 missense probably damaging 1.00
R1444:Lrit1 UTSW 14 37061971 missense probably benign
R1500:Lrit1 UTSW 14 37062134 missense probably benign 0.23
R1884:Lrit1 UTSW 14 37061753 missense possibly damaging 0.94
R2880:Lrit1 UTSW 14 37057437 missense probably damaging 1.00
R4784:Lrit1 UTSW 14 37062236 missense possibly damaging 0.79
R4855:Lrit1 UTSW 14 37061816 missense possibly damaging 0.75
R5100:Lrit1 UTSW 14 37062214 missense possibly damaging 0.74
R5365:Lrit1 UTSW 14 37062142 missense probably benign 0.00
R5474:Lrit1 UTSW 14 37061986 missense probably benign
R5614:Lrit1 UTSW 14 37061954 missense probably benign 0.39
R5688:Lrit1 UTSW 14 37062428 missense possibly damaging 0.66
R5926:Lrit1 UTSW 14 37055009 missense probably damaging 1.00
R6063:Lrit1 UTSW 14 37054988 missense probably benign 0.05
R6920:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6940:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6941:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6943:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6945:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6957:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6958:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6959:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6960:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6962:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R7784:Lrit1 UTSW 14 37061780 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGTGTTTATCCCATGGC -3'
(R):5'- TGCAAGGGTCCCAAATCCAG -3'

Sequencing Primer
(F):5'- ATCCCATGGCCTTGGATGG -3'
(R):5'- TCCAGTATACCAAGTGGGAGC -3'
Posted On2016-10-06