Incidental Mutation 'R5475:Fbxo34'
ID434040
Institutional Source Beutler Lab
Gene Symbol Fbxo34
Ensembl Gene ENSMUSG00000037536
Gene NameF-box protein 34
Synonyms5830426G16Rik, 2900057B08Rik
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location47450421-47531962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47529345 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000154565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043112] [ENSMUST00000095941] [ENSMUST00000163324] [ENSMUST00000165714] [ENSMUST00000168833] [ENSMUST00000226395] [ENSMUST00000226432] [ENSMUST00000226954] [ENSMUST00000228019] [ENSMUST00000228668] [ENSMUST00000228740]
Predicted Effect probably benign
Transcript: ENSMUST00000043112
AA Change: V105A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000044675
Gene: ENSMUSG00000037536
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 8 45 N/A INTRINSIC
FBOX 613 653 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095941
AA Change: V54A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000093634
Gene: ENSMUSG00000037536
AA Change: V54A

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163324
AA Change: V54A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000131708
Gene: ENSMUSG00000037536
AA Change: V54A

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165714
AA Change: V54A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130036
Gene: ENSMUSG00000037536
AA Change: V54A

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168833
AA Change: V54A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132271
Gene: ENSMUSG00000037536
AA Change: V54A

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226395
AA Change: V54A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000226432
AA Change: V54A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000226954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227162
Predicted Effect probably benign
Transcript: ENSMUST00000227601
Predicted Effect probably benign
Transcript: ENSMUST00000228019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228634
Predicted Effect probably benign
Transcript: ENSMUST00000228668
AA Change: V54A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228740
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Fbxo34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Fbxo34 APN 14 47529474 missense probably damaging 0.97
IGL01337:Fbxo34 APN 14 47530217 missense probably benign 0.05
IGL01418:Fbxo34 APN 14 47530784 missense possibly damaging 0.46
IGL02069:Fbxo34 APN 14 47529613 missense probably damaging 1.00
IGL02829:Fbxo34 APN 14 47529689 missense probably benign 0.00
R0601:Fbxo34 UTSW 14 47530257 missense probably benign
R0714:Fbxo34 UTSW 14 47530029 missense probably damaging 1.00
R1186:Fbxo34 UTSW 14 47530586 missense probably damaging 0.99
R1714:Fbxo34 UTSW 14 47529201 missense probably damaging 1.00
R1842:Fbxo34 UTSW 14 47531007 missense probably damaging 0.98
R2127:Fbxo34 UTSW 14 47530106 missense probably damaging 0.98
R4199:Fbxo34 UTSW 14 47530997 missense probably damaging 1.00
R4649:Fbxo34 UTSW 14 47529628 missense probably damaging 1.00
R4801:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4802:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4906:Fbxo34 UTSW 14 47529454 missense probably benign 0.26
R5888:Fbxo34 UTSW 14 47529719 missense probably damaging 0.98
R6573:Fbxo34 UTSW 14 47529667 missense possibly damaging 0.61
R7236:Fbxo34 UTSW 14 47530384 missense probably benign 0.00
R7257:Fbxo34 UTSW 14 47500872 critical splice donor site probably null
R7381:Fbxo34 UTSW 14 47530535 missense probably benign 0.02
R7515:Fbxo34 UTSW 14 47530341 missense possibly damaging 0.84
R7562:Fbxo34 UTSW 14 47529678 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTTCTCTTGCTAGAAACAGTAGG -3'
(R):5'- TTGACAATAGCCCAGGTCCC -3'

Sequencing Primer
(F):5'- GTAGGATACCTAAGTCAGCTCTC -3'
(R):5'- CAGGCAGCCCCTCCTCAC -3'
Posted On2016-10-06