Incidental Mutation 'R5475:Ank'
ID434044
Institutional Source Beutler Lab
Gene Symbol Ank
Ensembl Gene ENSMUSG00000022265
Gene Nameprogressive ankylosis
SynonymsD15Ertd221e
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location27466677-27594909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27557199 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 156 (K156N)
Ref Sequence ENSEMBL: ENSMUSP00000022875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022875] [ENSMUST00000228179]
Predicted Effect probably damaging
Transcript: ENSMUST00000022875
AA Change: K156N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022875
Gene: ENSMUSG00000022265
AA Change: K156N

DomainStartEndE-ValueType
Pfam:ANKH 1 345 1e-223 PFAM
transmembrane domain 361 383 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228179
Meta Mutation Damage Score 0.4878 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit joint stiffness due to increased calcium deposits in calcified cartilages and die prematurely. Hyperostosis of craniofacial bones and the mandible has been reported in other mutants as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Ank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ank APN 15 27544351 missense possibly damaging 0.53
IGL02975:Ank APN 15 27467001 utr 5 prime probably benign
R0309:Ank UTSW 15 27567572 missense possibly damaging 0.65
R0470:Ank UTSW 15 27571635 missense probably damaging 0.98
R1688:Ank UTSW 15 27557234 missense probably damaging 1.00
R1691:Ank UTSW 15 27590944 missense probably damaging 1.00
R2073:Ank UTSW 15 27565022 missense probably benign 0.20
R2248:Ank UTSW 15 27562711 splice site probably null
R3113:Ank UTSW 15 27571614 missense probably damaging 1.00
R4027:Ank UTSW 15 27544257 missense probably damaging 1.00
R4028:Ank UTSW 15 27544257 missense probably damaging 1.00
R4029:Ank UTSW 15 27544257 missense probably damaging 1.00
R4030:Ank UTSW 15 27544257 missense probably damaging 1.00
R4124:Ank UTSW 15 27571623 missense probably damaging 1.00
R4126:Ank UTSW 15 27590373 missense probably benign
R4508:Ank UTSW 15 27564977 missense probably damaging 1.00
R4517:Ank UTSW 15 27562749 missense possibly damaging 0.51
R4631:Ank UTSW 15 27467090 missense probably benign
R4653:Ank UTSW 15 27590361 missense probably null 0.98
R5001:Ank UTSW 15 27562733 missense probably damaging 0.99
R5029:Ank UTSW 15 27590353 missense probably benign 0.00
R7218:Ank UTSW 15 27544321 missense probably damaging 1.00
R7234:Ank UTSW 15 27571656 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCATCATCCACTCTGATCTAG -3'
(R):5'- TCCATATGGGATGCGAGCTG -3'

Sequencing Primer
(F):5'- GCTAGCCGCCAGATGAAGTTAC -3'
(R):5'- ATATGGGATGCGAGCTGAGTGC -3'
Posted On2016-10-06