Incidental Mutation 'R5475:Vmn2r105'
ID434049
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Namevomeronasal 2, receptor 105
SynonymsEG627743
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20208230-20234872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20234782 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 31 (I31L)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
Predicted Effect probably benign
Transcript: ENSMUST00000167382
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: I31L

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20228555 missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20224656 missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20208711 missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20227895 missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20209083 missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20227585 missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20226369 nonsense probably null
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20208565 missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20208676 missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20234703 missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20208316 missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R0765:Vmn2r105 UTSW 17 20227857 missense probably damaging 0.98
R1162:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20208322 missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20208670 missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20228742 splice site probably benign
R2029:Vmn2r105 UTSW 17 20224578 missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20227323 missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20208754 missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20228640 missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20226351 missense probably benign
R4801:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20208691 missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20228018 missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20208414 missense probably damaging 0.99
R5576:Vmn2r105 UTSW 17 20224574 critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20228736 missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20228667 missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20208627 missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20228496 missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20227730 nonsense probably null
R6542:Vmn2r105 UTSW 17 20228541 missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20208343 missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20209074 missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20208612 missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20208783 missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20228565 missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20227675 missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20208675 missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20234704 missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20208642 missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20224618 nonsense probably null
R8214:Vmn2r105 UTSW 17 20228513 missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20234872 start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20208610 missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20208967 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCATCAATCAAGTGAGGAAACC -3'
(R):5'- CTTGAATATGGGACCTCAGCTGC -3'

Sequencing Primer
(F):5'- TAAAAGTTGTCACAATAAAACCCCG -3'
(R):5'- CTCAGCTGCAGCAGTGAGAG -3'
Posted On2016-10-06