Incidental Mutation 'R0481:Glp1r'
ID43405
Institutional Source Beutler Lab
Gene Symbol Glp1r
Ensembl Gene ENSMUSG00000024027
Gene Nameglucagon-like peptide 1 receptor
SynonymsGLP-1R, GLP1Rc
MMRRC Submission 038681-MU
Accession Numbers

Genbank: NM_021332; MGI: 99571

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0481 (G1)
Quality Score223
Status Validated
Chromosome17
Chromosomal Location30901867-30936510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30931217 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 371 (M371K)
Ref Sequence ENSEMBL: ENSMUSP00000110221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114574]
Predicted Effect probably benign
Transcript: ENSMUST00000114574
AA Change: M371K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110221
Gene: ENSMUSG00000024027
AA Change: M371K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
HormR 58 135 9.88e-27 SMART
Pfam:7tm_2 141 398 7.4e-82 PFAM
low complexity region 440 456 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Glucose tolerance and pancreatic secretion is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Glp1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Glp1r APN 17 30901917 missense possibly damaging 0.96
IGL00516:Glp1r APN 17 30925558 missense probably damaging 1.00
IGL00653:Glp1r APN 17 30930760 missense probably damaging 1.00
IGL00917:Glp1r APN 17 30919469 splice site probably benign
IGL02005:Glp1r APN 17 30924611 missense probably benign 0.03
IGL02411:Glp1r APN 17 30924511 missense probably damaging 1.00
IGL02889:Glp1r APN 17 30931144 splice site probably benign
IGL02928:Glp1r APN 17 30918937 missense probably benign 0.00
N/A:Glp1r UTSW 17 30931283 missense probably damaging 0.98
R0135:Glp1r UTSW 17 30924577 missense probably benign 0.00
R0395:Glp1r UTSW 17 30936338 missense probably benign 0.34
R0602:Glp1r UTSW 17 30909227 missense probably benign 0.12
R0841:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1232:Glp1r UTSW 17 30918931 missense probably benign
R1804:Glp1r UTSW 17 30930713 splice site probably null
R1846:Glp1r UTSW 17 30929935 critical splice acceptor site probably null
R1982:Glp1r UTSW 17 30925627 nonsense probably null
R1990:Glp1r UTSW 17 30930748 missense possibly damaging 0.53
R2091:Glp1r UTSW 17 30925549 missense probably damaging 0.97
R3432:Glp1r UTSW 17 30924557 missense probably damaging 1.00
R4456:Glp1r UTSW 17 30918975 nonsense probably null
R4488:Glp1r UTSW 17 30918931 missense probably benign
R4610:Glp1r UTSW 17 30931247 missense probably benign 0.03
R4884:Glp1r UTSW 17 30936266 missense probably damaging 1.00
R5055:Glp1r UTSW 17 30918887 missense probably benign
R6358:Glp1r UTSW 17 30932644 missense probably benign 0.07
R6359:Glp1r UTSW 17 30929972 missense probably damaging 1.00
R6490:Glp1r UTSW 17 30924572 missense probably damaging 0.98
R6698:Glp1r UTSW 17 30936401 missense probably damaging 1.00
R7063:Glp1r UTSW 17 30925558 missense probably damaging 1.00
R7165:Glp1r UTSW 17 30909323 missense probably benign 0.23
R7293:Glp1r UTSW 17 30924625 missense probably benign 0.00
X0064:Glp1r UTSW 17 30919463 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCTATTCTTAGCAGCCCCTGGAC -3'
(R):5'- TGCATCAATTGCCTGGCAGGAC -3'

Sequencing Primer
(F):5'- AAGCGTGTTCATGACTCAGC -3'
(R):5'- TATGTCCAAATACCTGGGGACAC -3'
Posted On2013-05-23