Incidental Mutation 'R5475:Kat2b'
ID434052
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 043036-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 53663581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 665 (V665G)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000166525]
Predicted Effect probably damaging
Transcript: ENSMUST00000000724
AA Change: V665G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: V665G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167092
Predicted Effect unknown
Transcript: ENSMUST00000171072
AA Change: V75G
SMART Domains Protein: ENSMUSP00000127807
Gene: ENSMUSG00000000708
AA Change: V75G

DomainStartEndE-ValueType
SCOP:d1qsta_ 2 48 6e-26 SMART
PDB:1CM0|A 2 50 1e-28 PDB
low complexity region 54 70 N/A INTRINSIC
Blast:BROMO 71 98 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172160
Meta Mutation Damage Score 0.7055 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr923 T A 9: 38,828,466 F258L possibly damaging Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTACCTGCTAATGTGTATTCAGCC -3'
(R):5'- TGCTGCCCACTTCAAAGACC -3'

Sequencing Primer
(F):5'- GCTAATGTGTATTCAGCCTTTTTGTC -3'
(R):5'- GAGAGCTTTTCAAAGGACTGCACTC -3'
Posted On2016-10-06