Incidental Mutation 'R5476:Pard3b'
ID 434059
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Name par-3 family cell polarity regulator beta
Synonyms PAR3L, PAR3B, 1810008K04Rik, 2010002N16Rik, PAR3beta, Als2cr19, 2810455B10Rik
MMRRC Submission 043037-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5476 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 61677983-62681443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62049565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 108 (V108L)
Ref Sequence ENSEMBL: ENSMUSP00000074837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
AlphaFold Q9CSB4
PDB Structure Solution structure of PDZ domain in protein XP_110852 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000046673
AA Change: V108L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: V108L

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075374
AA Change: V108L

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: V108L

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094906
AA Change: V108L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: V108L

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138768
SMART Domains Protein: ENSMUSP00000116912
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 7e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188325
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 44,791,493 (GRCm39) N71H possibly damaging Het
Alg5 T A 3: 54,654,019 (GRCm39) S252T probably benign Het
Arhgap21 T C 2: 20,885,497 (GRCm39) N560S probably benign Het
Ccdc96 A G 5: 36,642,981 (GRCm39) D329G possibly damaging Het
Cep128 T C 12: 91,180,392 (GRCm39) E917G probably damaging Het
Cpox G C 16: 58,499,088 (GRCm39) V434L probably damaging Het
D5Ertd579e G T 5: 36,772,601 (GRCm39) S598Y probably damaging Het
Ddx6 A G 9: 44,518,753 (GRCm39) R22G possibly damaging Het
Dgcr8 A T 16: 18,077,843 (GRCm39) Y597N probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dock5 T C 14: 68,051,456 (GRCm39) D671G possibly damaging Het
Dock6 A G 9: 21,720,885 (GRCm39) S1707P probably damaging Het
Dop1b A G 16: 93,570,801 (GRCm39) probably null Het
Faim A G 9: 98,874,782 (GRCm39) R110G probably damaging Het
Grm4 A G 17: 27,653,772 (GRCm39) V726A probably benign Het
Hps1 T C 19: 42,758,041 (GRCm39) probably null Het
Lefty1 T C 1: 180,765,263 (GRCm39) M277T probably benign Het
Mmp9 A G 2: 164,794,414 (GRCm39) M469V probably benign Het
Mroh4 A T 15: 74,483,510 (GRCm39) I609N probably benign Het
Myl6b C T 10: 128,333,216 (GRCm39) probably benign Het
Nt5m A G 11: 59,766,733 (GRCm39) D208G probably damaging Het
Pbp2 A G 6: 135,286,922 (GRCm39) S142P probably benign Het
Pbrm1 T A 14: 30,754,476 (GRCm39) D165E probably benign Het
Pde4b A G 4: 102,459,896 (GRCm39) K577R probably benign Het
Phf21b A G 15: 84,671,466 (GRCm39) M476T probably benign Het
Prr14l T C 5: 33,001,482 (GRCm39) probably benign Het
Ralgapa2 A G 2: 146,289,356 (GRCm39) V282A probably benign Het
Rif1 A G 2: 51,979,607 (GRCm39) I430V probably damaging Het
Slc25a12 A G 2: 71,105,666 (GRCm39) S623P probably benign Het
Smc1b A T 15: 84,970,352 (GRCm39) I967N probably damaging Het
Snx13 A G 12: 35,156,819 (GRCm39) probably null Het
Spata2 A T 2: 167,326,079 (GRCm39) S247T probably damaging Het
Stpg2 T A 3: 138,948,899 (GRCm39) Y232N probably benign Het
Tor3a G T 1: 156,501,137 (GRCm39) S100R possibly damaging Het
Trappc8 A G 18: 20,998,165 (GRCm39) F385S probably damaging Het
Uggt2 T A 14: 119,328,121 (GRCm39) T134S probably benign Het
Vmn1r175 C T 7: 23,508,556 (GRCm39) V24I possibly damaging Het
Wdr1 C T 5: 38,686,931 (GRCm39) G278S probably damaging Het
Zfp157 T G 5: 138,455,443 (GRCm39) V547G possibly damaging Het
Zfp442 A T 2: 150,250,079 (GRCm39) C551S probably damaging Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62,200,357 (GRCm39) missense probably damaging 0.99
IGL01363:Pard3b APN 1 62,676,799 (GRCm39) missense probably damaging 1.00
IGL01509:Pard3b APN 1 62,200,407 (GRCm39) missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62,677,021 (GRCm39) missense probably damaging 0.96
IGL01651:Pard3b APN 1 62,518,963 (GRCm39) intron probably benign
IGL01670:Pard3b APN 1 62,250,807 (GRCm39) missense probably damaging 1.00
IGL02156:Pard3b APN 1 61,807,109 (GRCm39) missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62,205,541 (GRCm39) missense probably damaging 1.00
IGL02450:Pard3b APN 1 62,571,835 (GRCm39) missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62,237,930 (GRCm39) splice site probably benign
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0060:Pard3b UTSW 1 61,678,474 (GRCm39) missense probably damaging 0.97
R0157:Pard3b UTSW 1 62,250,792 (GRCm39) missense probably damaging 0.96
R0333:Pard3b UTSW 1 62,269,371 (GRCm39) missense probably benign 0.00
R0448:Pard3b UTSW 1 62,205,628 (GRCm39) missense probably damaging 1.00
R0465:Pard3b UTSW 1 62,250,877 (GRCm39) splice site probably benign
R0497:Pard3b UTSW 1 62,479,167 (GRCm39) splice site probably null
R1264:Pard3b UTSW 1 62,203,316 (GRCm39) missense probably damaging 1.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1482:Pard3b UTSW 1 62,205,526 (GRCm39) missense probably damaging 1.00
R1554:Pard3b UTSW 1 62,677,053 (GRCm39) missense probably damaging 0.97
R1836:Pard3b UTSW 1 62,676,763 (GRCm39) missense probably benign 0.03
R2005:Pard3b UTSW 1 62,184,050 (GRCm39) missense probably benign 0.12
R2220:Pard3b UTSW 1 62,518,842 (GRCm39) nonsense probably null
R2435:Pard3b UTSW 1 62,626,897 (GRCm39) missense probably damaging 1.00
R3015:Pard3b UTSW 1 62,384,037 (GRCm39) missense probably damaging 1.00
R3688:Pard3b UTSW 1 62,518,728 (GRCm39) missense probably benign
R3712:Pard3b UTSW 1 62,383,137 (GRCm39) missense probably damaging 1.00
R3799:Pard3b UTSW 1 62,200,388 (GRCm39) missense probably benign 0.06
R3942:Pard3b UTSW 1 62,198,611 (GRCm39) missense probably damaging 1.00
R4683:Pard3b UTSW 1 62,255,675 (GRCm39) missense probably benign
R4729:Pard3b UTSW 1 62,250,843 (GRCm39) missense probably damaging 1.00
R4898:Pard3b UTSW 1 61,807,159 (GRCm39) missense probably damaging 1.00
R4981:Pard3b UTSW 1 62,383,219 (GRCm39) missense probably damaging 1.00
R5049:Pard3b UTSW 1 62,200,320 (GRCm39) missense probably benign 0.01
R5223:Pard3b UTSW 1 62,383,272 (GRCm39) missense probably damaging 1.00
R5541:Pard3b UTSW 1 61,678,502 (GRCm39) missense probably damaging 1.00
R5672:Pard3b UTSW 1 62,049,625 (GRCm39) missense probably benign 0.11
R5714:Pard3b UTSW 1 62,677,075 (GRCm39) missense probably null 0.99
R5722:Pard3b UTSW 1 62,479,160 (GRCm39) splice site probably null
R5793:Pard3b UTSW 1 61,807,132 (GRCm39) missense probably damaging 1.00
R5930:Pard3b UTSW 1 61,807,289 (GRCm39) intron probably benign
R5950:Pard3b UTSW 1 62,255,690 (GRCm39) missense probably benign 0.04
R5997:Pard3b UTSW 1 62,115,568 (GRCm39) missense probably damaging 1.00
R6646:Pard3b UTSW 1 62,200,280 (GRCm39) missense probably benign 0.32
R6720:Pard3b UTSW 1 62,198,629 (GRCm39) missense probably damaging 0.99
R6809:Pard3b UTSW 1 62,200,340 (GRCm39) missense probably damaging 1.00
R7148:Pard3b UTSW 1 62,479,191 (GRCm39) missense probably benign 0.01
R7847:Pard3b UTSW 1 62,383,093 (GRCm39) missense probably benign 0.00
R7879:Pard3b UTSW 1 62,198,670 (GRCm39) missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62,193,148 (GRCm39) missense probably damaging 1.00
R8125:Pard3b UTSW 1 61,807,143 (GRCm39) missense probably damaging 1.00
R8329:Pard3b UTSW 1 62,676,957 (GRCm39) missense probably benign 0.30
R8766:Pard3b UTSW 1 62,198,637 (GRCm39) missense probably benign 0.35
R8833:Pard3b UTSW 1 62,384,158 (GRCm39) missense probably benign 0.00
R8889:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8892:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8907:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R8909:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R9215:Pard3b UTSW 1 62,203,344 (GRCm39) missense probably damaging 1.00
R9310:Pard3b UTSW 1 62,205,528 (GRCm39) missense probably damaging 0.99
R9542:Pard3b UTSW 1 62,250,786 (GRCm39) nonsense probably null
Z1176:Pard3b UTSW 1 62,278,051 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCGACATTTGCTTTAAGGCC -3'
(R):5'- GCCTTAGGAAAAGAACTTAGGTGAC -3'

Sequencing Primer
(F):5'- GCTTTAAGGCCAAGTAAAGATCAC -3'
(R):5'- TGACAAACCAGATGTCTTTATAAAGG -3'
Posted On 2016-10-06