Incidental Mutation 'R5476:Zfp442'
ID434067
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150408159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 551 (C551S)
Ref Sequence ENSEMBL: ENSMUSP00000140098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect probably benign
Transcript: ENSMUST00000109916
AA Change: C608S

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: C608S

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: C551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: C551S

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R7931:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATAGAAATGTACAAAGGCTTCACC -3'
(R):5'- ACACTGGTGAGAAGCCATATG -3'

Sequencing Primer
(F):5'- CTCTGAAGATGTCTGACATGCCAAG -3'
(R):5'- GCCATATGAATGTAGTGAATGTGG -3'
Posted On2016-10-06