Incidental Mutation 'R5476:Alg5'
ID434070
Institutional Source Beutler Lab
Gene Symbol Alg5
Ensembl Gene ENSMUSG00000036632
Gene Nameasparagine-linked glycosylation 5 (dolichyl-phosphate beta-glucosyltransferase)
Synonyms2600005J22Rik, 1500026A19Rik
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54735539-54751318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54746598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 252 (S252T)
Ref Sequence ENSEMBL: ENSMUSP00000035879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000155273]
Predicted Effect probably benign
Transcript: ENSMUST00000044567
AA Change: S252T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632
AA Change: S252T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation arrest unturned at E9.5 and display no left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Alg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Alg5 APN 3 54744719 splice site probably benign
R2008:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R3428:Alg5 UTSW 3 54735585 start codon destroyed probably null
R3547:Alg5 UTSW 3 54749315 missense probably benign 0.15
R4372:Alg5 UTSW 3 54738955 critical splice donor site probably null
R4764:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R5128:Alg5 UTSW 3 54742137 splice site probably null
R5638:Alg5 UTSW 3 54738833 missense probably benign 0.22
R6880:Alg5 UTSW 3 54738843 missense probably damaging 1.00
R6897:Alg5 UTSW 3 54748642 missense probably benign
R7317:Alg5 UTSW 3 54749331 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCAATGTCTCAGGGATGC -3'
(R):5'- TTAACGGCCACACTGCAGAG -3'

Sequencing Primer
(F):5'- CCTCAATGTCTCAGGGATGCTAAATC -3'
(R):5'- TGCAGAGAGAGACCTACCTCCG -3'
Posted On2016-10-06