Incidental Mutation 'R5476:Ccdc96'
ID434074
Institutional Source Beutler Lab
Gene Symbol Ccdc96
Ensembl Gene ENSMUSG00000050677
Gene Namecoiled-coil domain containing 96
Synonyms
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36484588-36488172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36485637 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 329 (D329G)
Ref Sequence ENSEMBL: ENSMUSP00000059636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031094] [ENSMUST00000031097] [ENSMUST00000060100] [ENSMUST00000119916] [ENSMUST00000126077] [ENSMUST00000136189] [ENSMUST00000140607] [ENSMUST00000146430] [ENSMUST00000171385]
Predicted Effect probably benign
Transcript: ENSMUST00000031094
SMART Domains Protein: ENSMUSP00000031094
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031097
SMART Domains Protein: ENSMUSP00000031097
Gene: ENSMUSG00000029196

DomainStartEndE-ValueType
ZnF_ZZ 3 46 2.64e-5 SMART
SANT 66 116 1.75e-9 SMART
low complexity region 138 154 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060100
AA Change: D329G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059636
Gene: ENSMUSG00000050677
AA Change: D329G

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
SCOP:d1qbkb_ 99 144 6e-3 SMART
low complexity region 223 234 N/A INTRINSIC
coiled coil region 315 355 N/A INTRINSIC
Pfam:DUF4201 394 570 9.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119916
SMART Domains Protein: ENSMUSP00000114124
Gene: ENSMUSG00000029196

DomainStartEndE-ValueType
Blast:SANT 16 41 2e-10 BLAST
low complexity region 63 79 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 231 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126077
SMART Domains Protein: ENSMUSP00000114508
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136189
SMART Domains Protein: ENSMUSP00000115467
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 247 322 1e-32 BLAST
TBC 399 559 8.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140607
SMART Domains Protein: ENSMUSP00000121516
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146430
SMART Domains Protein: ENSMUSP00000121816
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171385
SMART Domains Protein: ENSMUSP00000131876
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Ccdc96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ccdc96 APN 5 36485080 unclassified probably benign
R0167:Ccdc96 UTSW 5 36485153 missense probably benign 0.18
R0302:Ccdc96 UTSW 5 36486101 missense possibly damaging 0.51
R0423:Ccdc96 UTSW 5 36485247 missense probably benign 0.41
R0532:Ccdc96 UTSW 5 36486366 missense probably benign 0.18
R3800:Ccdc96 UTSW 5 36486267 missense probably damaging 1.00
R3977:Ccdc96 UTSW 5 36485166 missense possibly damaging 0.96
R4575:Ccdc96 UTSW 5 36486075 missense possibly damaging 0.88
R4720:Ccdc96 UTSW 5 36484875 unclassified probably benign
R5945:Ccdc96 UTSW 5 36485850 missense probably damaging 1.00
R5995:Ccdc96 UTSW 5 36486374 missense probably damaging 0.99
R6434:Ccdc96 UTSW 5 36486363 missense probably damaging 1.00
R6493:Ccdc96 UTSW 5 36486252 missense probably damaging 0.99
R6632:Ccdc96 UTSW 5 36485189 missense probably benign 0.07
R6633:Ccdc96 UTSW 5 36485189 missense probably benign 0.07
R7395:Ccdc96 UTSW 5 36485265 missense probably benign 0.29
R7819:Ccdc96 UTSW 5 36485985 missense probably damaging 0.98
X0022:Ccdc96 UTSW 5 36486374 missense probably damaging 1.00
Z1176:Ccdc96 UTSW 5 36485594 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTACCACTCCCTGCTAGTG -3'
(R):5'- TTCTTATCCTCCAGGGCCTGAAG -3'

Sequencing Primer
(F):5'- CTAGTGGAGCGGAACCGTTATC -3'
(R):5'- TCCAGGGCCTGAAGCTGTTC -3'
Posted On2016-10-06