Incidental Mutation 'R5476:Wdr1'
ID434076
Institutional Source Beutler Lab
Gene Symbol Wdr1
Ensembl Gene ENSMUSG00000005103
Gene NameWD repeat domain 1
SynonymsAip1, rede, D5Wsu185e
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38526813-38563221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38529588 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 278 (G278S)
Ref Sequence ENSEMBL: ENSMUSP00000143937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005234] [ENSMUST00000201260]
Predicted Effect probably damaging
Transcript: ENSMUST00000005234
AA Change: G551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005234
Gene: ENSMUSG00000005103
AA Change: G551S

DomainStartEndE-ValueType
WD40 47 86 1.7e-2 SMART
WD40 91 134 5.52e0 SMART
WD40 135 175 3.69e-3 SMART
WD40 178 217 4.4e-10 SMART
WD40 220 262 1.74e-8 SMART
WD40 309 350 7.05e-9 SMART
WD40 354 392 6.9e-1 SMART
WD40 434 473 1.36e-1 SMART
WD40 478 517 7.8e-2 SMART
WD40 521 560 1.83e-7 SMART
WD40 564 603 3.71e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201059
Predicted Effect probably damaging
Transcript: ENSMUST00000201260
AA Change: G278S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143937
Gene: ENSMUSG00000005103
AA Change: G278S

DomainStartEndE-ValueType
WD40 36 77 4.6e-11 SMART
WD40 81 119 4.5e-3 SMART
WD40 161 200 8.9e-4 SMART
WD40 205 244 4.9e-4 SMART
WD40 248 287 1.2e-9 SMART
WD40 291 330 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202496
Meta Mutation Damage Score 0.4249 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Severe loss of function at this locus causes embryonic lethality. Mice homozygous for a hypomorphic ENU-induced allele exhibit thrombocytopenia due to impaired megakaryocyte maturation and platelet shedding, and develop autoinflammatory disease associated with defects in neutrophil function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Wdr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Wdr1 APN 5 38535323 missense probably benign 0.00
IGL01071:Wdr1 APN 5 38530067 missense probably benign 0.14
IGL01293:Wdr1 APN 5 38529543 missense probably benign 0.00
IGL01347:Wdr1 APN 5 38545715 missense possibly damaging 0.77
IGL01532:Wdr1 APN 5 38535187 missense probably damaging 1.00
IGL02409:Wdr1 APN 5 38531110 missense probably benign 0.06
IGL02415:Wdr1 APN 5 38531110 missense probably damaging 1.00
IGL02543:Wdr1 APN 5 38545822 missense probably damaging 1.00
IGL02550:Wdr1 APN 5 38540863 missense probably damaging 1.00
IGL03093:Wdr1 APN 5 38561129 missense probably benign 0.01
IGL03183:Wdr1 APN 5 38533482 critical splice donor site probably null
R0724:Wdr1 UTSW 5 38540862 missense possibly damaging 0.87
R1509:Wdr1 UTSW 5 38540562 missense probably damaging 0.96
R1589:Wdr1 UTSW 5 38529972 missense probably benign 0.43
R3039:Wdr1 UTSW 5 38530085 missense possibly damaging 0.94
R3767:Wdr1 UTSW 5 38540539 missense probably damaging 1.00
R4833:Wdr1 UTSW 5 38547029 missense probably damaging 1.00
R5405:Wdr1 UTSW 5 38535200 missense probably benign 0.03
R5475:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5619:Wdr1 UTSW 5 38529536 missense possibly damaging 0.93
R5852:Wdr1 UTSW 5 38537175 missense probably benign 0.00
R5876:Wdr1 UTSW 5 38530023 missense probably benign 0.01
R6170:Wdr1 UTSW 5 38529671 critical splice acceptor site probably null
R6367:Wdr1 UTSW 5 38545846 missense possibly damaging 0.68
R6524:Wdr1 UTSW 5 38530063 missense probably benign 0.07
R6643:Wdr1 UTSW 5 38540178 missense probably damaging 1.00
R6838:Wdr1 UTSW 5 38530031 missense probably damaging 0.96
R7305:Wdr1 UTSW 5 38540092 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGTCTCAGGGTTCCTCTGCAG -3'
(R):5'- CCTGTTACTTCAAGGGCTGG -3'

Sequencing Primer
(F):5'- TGGAGCCACATTTCATCAGG -3'
(R):5'- CTGGCTGGGAGGACACATG -3'
Posted On2016-10-06