Incidental Mutation 'R5476:Aldh16a1'
ID434080
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Namealdehyde dehydrogenase 16 family, member A1
Synonyms
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45140684-45154584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45142069 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 71 (N71H)
Ref Sequence ENSEMBL: ENSMUSP00000148006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209963] [ENSMUST00000211169]
Predicted Effect probably benign
Transcript: ENSMUST00000007977
AA Change: N761H

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000007977
Gene: ENSMUSG00000007833
AA Change: N761H

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 1.1e-84 PFAM
Pfam:Aldedh 537 774 4.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107815
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126618
AA Change: N897H
Predicted Effect possibly damaging
Transcript: ENSMUST00000134655
AA Change: N71H

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119021
Gene: ENSMUSG00000007833
AA Change: N71H

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect possibly damaging
Transcript: ENSMUST00000209963
AA Change: N761H

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect possibly damaging
Transcript: ENSMUST00000211169
AA Change: N71H

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 45145513 missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 45141967 missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 45142093 missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 45145594 missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 45141975 missense possibly damaging 0.85
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 45147979 missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 45142838 missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 45146229 unclassified probably null
R0707:Aldh16a1 UTSW 7 45144507 unclassified probably benign
R0801:Aldh16a1 UTSW 7 45147476 missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 45142047 unclassified probably null
R1371:Aldh16a1 UTSW 7 45147250 missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 45147308 missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 45147161 critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 45148788 intron probably benign
R4859:Aldh16a1 UTSW 7 45147307 missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R5591:Aldh16a1 UTSW 7 45144652 missense probably null 0.82
R5647:Aldh16a1 UTSW 7 45154465 missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 45147799 missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 45154407 unclassified probably benign
R5879:Aldh16a1 UTSW 7 45147506 nonsense probably null
R5890:Aldh16a1 UTSW 7 45144545 missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 45149765 missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 45146271 missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 45144937 missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 45143227 missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 45145594 missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 45147904 missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 45145907 missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 45147531 missense unknown
R7830:Aldh16a1 UTSW 7 45146225 missense probably damaging 0.98
Z1177:Aldh16a1 UTSW 7 45145903 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAAACGTTCCAAGCACTTG -3'
(R):5'- CTGGGCAAGATGAGGATTCC -3'

Sequencing Primer
(F):5'- TGCTCCTGAGCATCAAAG -3'
(R):5'- GCAAGATGAGGATTCCCTAGATCTAC -3'
Posted On2016-10-06