Incidental Mutation 'R5476:Ddx6'
ID434083
Institutional Source Beutler Lab
Gene Symbol Ddx6
Ensembl Gene ENSMUSG00000032097
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 6
SynonymsmRCK/P54, HLR2, rck, C430015D01Rik, 1110001P04Rik, p54, E230023J21Rik
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44604892-44640731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44607456 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 22 (R22G)
Ref Sequence ENSEMBL: ENSMUSP00000149620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170489] [ENSMUST00000217034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170489
AA Change: R22G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128421
Gene: ENSMUSG00000032097
AA Change: R22G

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Blast:DEXDc 42 88 7e-18 BLAST
DEXDc 115 312 3.67e-52 SMART
HELICc 348 429 1.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214898
Predicted Effect possibly damaging
Transcript: ENSMUST00000217034
AA Change: R22G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Ddx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02561:Ddx6 APN 9 44634168 missense probably damaging 0.96
IGL02880:Ddx6 APN 9 44612897 splice site probably benign
R0278:Ddx6 UTSW 9 44631425 missense probably damaging 1.00
R1330:Ddx6 UTSW 9 44627773 splice site probably benign
R2001:Ddx6 UTSW 9 44607534 missense probably benign
R2002:Ddx6 UTSW 9 44607534 missense probably benign
R2124:Ddx6 UTSW 9 44624519 nonsense probably null
R2177:Ddx6 UTSW 9 44627731 missense probably damaging 1.00
R2347:Ddx6 UTSW 9 44607591 missense probably benign 0.00
R2863:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R2865:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R4584:Ddx6 UTSW 9 44624487 missense probably damaging 1.00
R4915:Ddx6 UTSW 9 44612873 missense probably damaging 1.00
R6213:Ddx6 UTSW 9 44628693 missense probably damaging 0.99
R6264:Ddx6 UTSW 9 44628752 missense probably damaging 1.00
R6368:Ddx6 UTSW 9 44635776 missense probably damaging 1.00
R6525:Ddx6 UTSW 9 44623629 missense probably damaging 1.00
R6994:Ddx6 UTSW 9 44628723 missense probably damaging 0.98
R7252:Ddx6 UTSW 9 44623753 splice site probably null
R7463:Ddx6 UTSW 9 44628729 missense probably damaging 1.00
R7706:Ddx6 UTSW 9 44627642 missense probably damaging 1.00
R7752:Ddx6 UTSW 9 44627663 missense probably damaging 1.00
R7784:Ddx6 UTSW 9 44630142 critical splice donor site probably null
RF004:Ddx6 UTSW 9 44624492 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGACTTACAGGTGCTTGCC -3'
(R):5'- TAACCAGAAACTGCGGGTC -3'

Sequencing Primer
(F):5'- GTGCTTGCCTGAACTGCAATAAAG -3'
(R):5'- AGAAACTGCGGGTCCCCAAG -3'
Posted On2016-10-06