Incidental Mutation 'R5476:Faim'
ID434084
Institutional Source Beutler Lab
Gene Symbol Faim
Ensembl Gene ENSMUSG00000032463
Gene NameFas apoptotic inhibitory molecule
SynonymsFaim-L, Faim-S
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location98986373-99002021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98992729 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 110 (R110G)
Ref Sequence ENSEMBL: ENSMUSP00000140627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035038] [ENSMUST00000112911] [ENSMUST00000185472]
Predicted Effect probably damaging
Transcript: ENSMUST00000035038
AA Change: R110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035038
Gene: ENSMUSG00000032463
AA Change: R110G

DomainStartEndE-ValueType
Pfam:FAIM1 1 177 3e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112911
AA Change: R132G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108532
Gene: ENSMUSG00000032463
AA Change: R132G

DomainStartEndE-ValueType
Pfam:FAIM1 25 197 9.8e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185472
AA Change: R110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140627
Gene: ENSMUSG00000032463
AA Change: R110G

DomainStartEndE-ValueType
Pfam:FAIM1 1 175 1.8e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187211
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene protects against death receptor-triggered apoptosis and regulates B-cell signaling and differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele have thymocytes with an enhanced susceptibility to FAS-induced apoptosis, and B cells that more susceptible to activation induced cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Faim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Faim APN 9 98992165 missense probably damaging 1.00
IGL00783:Faim APN 9 98992165 missense probably damaging 1.00
IGL00784:Faim APN 9 98992165 missense probably damaging 1.00
IGL00785:Faim APN 9 98992165 missense probably damaging 1.00
IGL00786:Faim APN 9 98992165 missense probably damaging 1.00
IGL00809:Faim APN 9 98992165 missense probably damaging 1.00
IGL00811:Faim APN 9 98992165 missense probably damaging 1.00
IGL00813:Faim APN 9 98992165 missense probably damaging 1.00
IGL00814:Faim APN 9 98992165 missense probably damaging 1.00
IGL00815:Faim APN 9 98992165 missense probably damaging 1.00
IGL00816:Faim APN 9 98992165 missense probably damaging 1.00
IGL00817:Faim APN 9 98992165 missense probably damaging 1.00
IGL00821:Faim APN 9 98992165 missense probably damaging 1.00
IGL01330:Faim APN 9 98992535 missense probably damaging 1.00
IGL01925:Faim APN 9 98990919 unclassified probably benign
IGL02703:Faim APN 9 98992201 missense probably benign 0.09
R0638:Faim UTSW 9 98992096 splice site probably benign
R1251:Faim UTSW 9 98992634 missense probably damaging 0.99
R5901:Faim UTSW 9 98992142 missense probably benign 0.01
R6250:Faim UTSW 9 98992123 start codon destroyed probably benign 0.15
R7282:Faim UTSW 9 98992126 missense probably benign
R8034:Faim UTSW 9 98992733 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAACGTTCTTTGTCGGAGCTG -3'
(R):5'- TAGCAAACAGTCGATGCCTGG -3'

Sequencing Primer
(F):5'- TCTTTGTCGGAGCTGCAAAAACC -3'
(R):5'- CAGTCGATGCCTGGATAGATATTAC -3'
Posted On2016-10-06