Incidental Mutation 'R5476:Snx13'
ID434089
Institutional Source Beutler Lab
Gene Symbol Snx13
Ensembl Gene ENSMUSG00000020590
Gene Namesorting nexin 13
SynonymsRGS-PX1
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location35047186-35147479 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 35106820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048519] [ENSMUST00000163677] [ENSMUST00000221272]
Predicted Effect probably null
Transcript: ENSMUST00000048519
SMART Domains Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 98 285 9.09e-102 SMART
coiled coil region 293 320 N/A INTRINSIC
RGS 374 514 4.63e-32 SMART
low complexity region 546 562 N/A INTRINSIC
PX 564 677 2.88e-31 SMART
Pfam:Nexin_C 793 903 1.9e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163677
SMART Domains Protein: ENSMUSP00000130182
Gene: ENSMUSG00000020590

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 97 284 9.09e-102 SMART
coiled coil region 292 319 N/A INTRINSIC
RGS 373 513 4.63e-32 SMART
low complexity region 545 561 N/A INTRINSIC
PX 563 676 2.88e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221876
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Snx13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snx13 APN 12 35098280 missense probably damaging 1.00
IGL01143:Snx13 APN 12 35132160 missense probably damaging 0.96
IGL01446:Snx13 APN 12 35124480 nonsense probably null
IGL01519:Snx13 APN 12 35138472 unclassified probably benign
IGL01902:Snx13 APN 12 35133307 critical splice acceptor site probably null
IGL01903:Snx13 APN 12 35085969 missense probably benign 0.06
IGL02146:Snx13 APN 12 35101079 missense probably benign 0.00
IGL02175:Snx13 APN 12 35132062 missense possibly damaging 0.83
IGL02197:Snx13 APN 12 35106801 missense probably damaging 1.00
IGL02200:Snx13 APN 12 35086885 missense probably damaging 1.00
IGL02476:Snx13 APN 12 35086941 missense probably damaging 1.00
IGL03171:Snx13 APN 12 35100540 missense probably benign 0.28
jiaozhi UTSW 12 35144220 missense probably damaging 0.98
resistance UTSW 12 35112445 missense probably damaging 1.00
IGL02835:Snx13 UTSW 12 35132127 missense possibly damaging 0.48
P0042:Snx13 UTSW 12 35107542 missense probably damaging 1.00
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0344:Snx13 UTSW 12 35086900 nonsense probably null
R1240:Snx13 UTSW 12 35091406 missense probably damaging 0.99
R1335:Snx13 UTSW 12 35132124 missense probably benign 0.16
R1451:Snx13 UTSW 12 35078984 missense probably benign 0.00
R1617:Snx13 UTSW 12 35086896 missense probably damaging 0.99
R2065:Snx13 UTSW 12 35138066 missense possibly damaging 0.91
R2111:Snx13 UTSW 12 35138085 missense probably damaging 1.00
R2385:Snx13 UTSW 12 35119793 missense probably benign 0.36
R2437:Snx13 UTSW 12 35082927 missense probably benign 0.14
R2511:Snx13 UTSW 12 35138081 missense probably benign 0.13
R2860:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2861:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2862:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2992:Snx13 UTSW 12 35105191 missense probably damaging 1.00
R3938:Snx13 UTSW 12 35144097 missense probably benign 0.10
R4304:Snx13 UTSW 12 35122942 missense probably benign 0.10
R4532:Snx13 UTSW 12 35144220 missense probably damaging 0.98
R4692:Snx13 UTSW 12 35086918 missense possibly damaging 0.82
R4783:Snx13 UTSW 12 35098286 missense probably damaging 1.00
R4914:Snx13 UTSW 12 35132033 missense possibly damaging 0.84
R5309:Snx13 UTSW 12 35144325 nonsense probably null
R5425:Snx13 UTSW 12 35100644 nonsense probably null
R5533:Snx13 UTSW 12 35123026 critical splice donor site probably null
R5564:Snx13 UTSW 12 35124472 missense possibly damaging 0.61
R5572:Snx13 UTSW 12 35103120 missense probably damaging 1.00
R5635:Snx13 UTSW 12 35140171 missense probably benign 0.00
R6018:Snx13 UTSW 12 35047319 start gained probably benign
R6612:Snx13 UTSW 12 35106759 missense probably benign 0.19
R6618:Snx13 UTSW 12 35112445 missense probably damaging 1.00
R6737:Snx13 UTSW 12 35140186 missense probably damaging 0.98
R6964:Snx13 UTSW 12 35119789 missense possibly damaging 0.81
R7186:Snx13 UTSW 12 35092913 missense probably damaging 0.99
R7372:Snx13 UTSW 12 35078951 missense probably benign 0.00
R7429:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7430:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7537:Snx13 UTSW 12 35085982 missense probably damaging 1.00
R7567:Snx13 UTSW 12 35086914 missense probably damaging 1.00
R7582:Snx13 UTSW 12 35124535 nonsense probably null
R7767:Snx13 UTSW 12 35107484 missense probably damaging 1.00
R7771:Snx13 UTSW 12 35124528 missense probably benign
R7838:Snx13 UTSW 12 35105175 missense probably benign 0.26
R7901:Snx13 UTSW 12 35100625 missense probably benign 0.02
R8029:Snx13 UTSW 12 35119886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATTCTGAAGTGCTGGTTCC -3'
(R):5'- ACTTACATCAATATGAGATTTTGAGGC -3'

Sequencing Primer
(F):5'- TTAATCCCAGCATTCGGGAG -3'
(R):5'- CTGGCTCTTCAGATTCAAACAAAG -3'
Posted On2016-10-06