Incidental Mutation 'R5476:Pbrm1'
ID434091
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Namepolybromo 1
SynonymsBAF180, Pb1, 2610016F04Rik, 2310032M22Rik
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31019138-31121592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31032519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 165 (D165E)
Ref Sequence ENSEMBL: ENSMUSP00000123546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000112106] [ENSMUST00000123678] [ENSMUST00000135704] [ENSMUST00000136237] [ENSMUST00000146325] [ENSMUST00000156628]
Predicted Effect probably benign
Transcript: ENSMUST00000022471
AA Change: D165E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022474
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052239
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090214
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112092
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112094
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112106
SMART Domains Protein: ENSMUSP00000107734
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 61 91 6e-16 BLAST
PDB:3IU5|A 61 91 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123678
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135704
AA Change: D109E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115505
Gene: ENSMUSG00000042323
AA Change: D109E

DomainStartEndE-ValueType
BROMO 1 97 3.24e-25 SMART
BROMO 119 233 5.84e-41 SMART
low complexity region 298 314 N/A INTRINSIC
BROMO 323 433 1.57e-32 SMART
BROMO 475 586 6.07e-39 SMART
BROMO 610 724 3.01e-43 SMART
BROMO 734 840 2.53e-18 SMART
low complexity region 862 892 N/A INTRINSIC
BAH 914 1032 1.33e-45 SMART
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136237
AA Change: D165E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145497
Predicted Effect probably benign
Transcript: ENSMUST00000146325
AA Change: D186E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323
AA Change: D186E

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156628
AA Change: D165E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323
AA Change: D165E

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 31030927 missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 31052283 missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 31032404 splice site probably benign
IGL00674:Pbrm1 APN 14 31118776 missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 31052248 missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 31087619 missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 31052260 missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 31082604 missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 31089616 missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 31032510 missense probably benign 0.00
IGL02675:Pbrm1 APN 14 31106287 missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 31061513 missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 31067804 missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 31061551 missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 31110549 missense probably benign 0.00
IGL03290:Pbrm1 APN 14 31107284 missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 31085019 missense probably benign 0.04
IGL03386:Pbrm1 APN 14 31050092 missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 31067861 missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R0552:Pbrm1 UTSW 14 31035959 missense probably damaging 1.00
R0558:Pbrm1 UTSW 14 31085059 unclassified probably null
R0561:Pbrm1 UTSW 14 31035991 missense probably benign
R0591:Pbrm1 UTSW 14 31046430 splice site probably benign
R0835:Pbrm1 UTSW 14 31067579 missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 31050142 missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 31118852 missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 31074814 missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 31067502 missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 31032548 missense probably benign 0.07
R1843:Pbrm1 UTSW 14 31038957 missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 31106175 missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 31074893 missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 31032475 missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 31036003 missense probably benign 0.00
R4280:Pbrm1 UTSW 14 31107312 critical splice donor site probably null
R4379:Pbrm1 UTSW 14 31067706 missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 31025556 missense probably benign 0.02
R4816:Pbrm1 UTSW 14 31110448 missense probably benign 0.32
R4939:Pbrm1 UTSW 14 31061623 missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 31052216 missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 31074827 missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 31032530 missense probably benign 0.00
R5276:Pbrm1 UTSW 14 31106184 missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 31082610 missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 31085011 missense probably damaging 0.96
R5522:Pbrm1 UTSW 14 31089563 missense probably damaging 1.00
R5548:Pbrm1 UTSW 14 31105424 missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 31035992 missense probably benign 0.20
R6089:Pbrm1 UTSW 14 31087585 missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 31052283 missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 31050111 missense probably benign 0.19
R6335:Pbrm1 UTSW 14 31084095 missense probably damaging 1.00
R6499:Pbrm1 UTSW 14 31061509 missense probably damaging 0.99
R6823:Pbrm1 UTSW 14 31084790 missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R7021:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R7216:Pbrm1 UTSW 14 31045422 missense possibly damaging 0.93
R7588:Pbrm1 UTSW 14 31084943 missense probably damaging 0.99
R7828:Pbrm1 UTSW 14 31030891 missense probably damaging 1.00
R8035:Pbrm1 UTSW 14 31084152 missense probably damaging 1.00
R8188:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
Z1088:Pbrm1 UTSW 14 31110454 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGATTTAAAACTAGGGATTGAGTCGTC -3'
(R):5'- CTGAACTAGCCCTTGGTAATATCATGG -3'

Sequencing Primer
(F):5'- GAGTCGTCAATAAAAGTAAATGTTCC -3'
(R):5'- GCACTGTCAGGATGTTTAAGATCAC -3'
Posted On2016-10-06