Incidental Mutation 'R5476:Trappc8'
ID434100
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Nametrafficking protein particle complex 8
SynonymsD030074E01Rik, Trs85, 5033403J15Rik
MMRRC Submission 043037-MU
Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20817223-20896093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20865108 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 385 (F385S)
Ref Sequence ENSEMBL: ENSMUSP00000153183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000097658] [ENSMUST00000224530] [ENSMUST00000225661]
Predicted Effect probably damaging
Transcript: ENSMUST00000025177
AA Change: F386S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: F386S

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097658
AA Change: F386S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095262
Gene: ENSMUSG00000033382
AA Change: F386S

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 152 605 9.3e-135 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224530
Predicted Effect probably damaging
Transcript: ENSMUST00000225661
AA Change: F385S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20836978 missense probably benign 0.20
IGL01367:Trappc8 APN 18 20866119 missense probably benign 0.01
IGL01537:Trappc8 APN 18 20835004 missense probably benign
IGL01563:Trappc8 APN 18 20837046 missense probably benign 0.00
IGL01982:Trappc8 APN 18 20874712 splice site probably benign
IGL02709:Trappc8 APN 18 20837178 missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20863595 missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20820935 missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20852781 missense probably damaging 1.00
hoppa UTSW 18 20836900 missense probably benign 0.05
Lagomorpha UTSW 18 20818190 missense probably benign 0.11
rabbit UTSW 18 20874680 missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20850918 missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20845601 missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20866186 missense probably benign 0.07
R0506:Trappc8 UTSW 18 20844188 missense possibly damaging 0.49
R0610:Trappc8 UTSW 18 20837188 missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20831608 critical splice donor site probably null
R1561:Trappc8 UTSW 18 20841623 nonsense probably null
R1589:Trappc8 UTSW 18 20863551 missense probably damaging 1.00
R1700:Trappc8 UTSW 18 20832998 missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20834940 splice site probably null
R1786:Trappc8 UTSW 18 20834940 splice site probably null
R1989:Trappc8 UTSW 18 20845651 missense probably benign 0.04
R2181:Trappc8 UTSW 18 20819222 critical splice donor site probably null
R2294:Trappc8 UTSW 18 20866154 nonsense probably null
R4551:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R4594:Trappc8 UTSW 18 20836948 missense probably benign
R4631:Trappc8 UTSW 18 20867808 missense probably benign 0.22
R4734:Trappc8 UTSW 18 20841572 nonsense probably null
R4834:Trappc8 UTSW 18 20825065 missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20844180 missense probably benign 0.04
R5262:Trappc8 UTSW 18 20818190 missense probably benign 0.11
R5384:Trappc8 UTSW 18 20833062 intron probably null
R5503:Trappc8 UTSW 18 20836900 missense probably benign 0.05
R5577:Trappc8 UTSW 18 20836779 nonsense probably null
R5809:Trappc8 UTSW 18 20818082 missense probably benign 0.08
R5825:Trappc8 UTSW 18 20873920 missense probably damaging 1.00
R5886:Trappc8 UTSW 18 20874680 missense probably damaging 1.00
R5936:Trappc8 UTSW 18 20874688 missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20833009 missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20846447 critical splice donor site probably null
R6229:Trappc8 UTSW 18 20870745 missense probably benign 0.00
R6376:Trappc8 UTSW 18 20837075 missense probably benign 0.07
R6403:Trappc8 UTSW 18 20866071 missense probably benign
R6459:Trappc8 UTSW 18 20836868 missense probably benign 0.40
R6673:Trappc8 UTSW 18 20885257 missense probably benign 0.01
R7041:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R7276:Trappc8 UTSW 18 20818091 missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20852647 missense probably damaging 1.00
R7684:Trappc8 UTSW 18 20863502 missense probably benign 0.01
R7702:Trappc8 UTSW 18 20825062 missense probably damaging 0.99
X0065:Trappc8 UTSW 18 20860522 missense probably benign 0.03
Z1177:Trappc8 UTSW 18 20831663 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTTTTGACCAGTATGGAAATAAACT -3'
(R):5'- GGGTACTAAACAAAACAAAACTGCTT -3'

Sequencing Primer
(F):5'- CACAACAACCCAGATGTATT -3'
(R):5'- GAGCAACTGAGCCATTTCTG -3'
Posted On2016-10-06