Incidental Mutation 'R5476:Hps1'
ID434101
Institutional Source Beutler Lab
Gene Symbol Hps1
Ensembl Gene ENSMUSG00000025188
Gene NameHPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms6030422N11Rik
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42755105-42779978 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 42769602 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026194] [ENSMUST00000026194] [ENSMUST00000069298] [ENSMUST00000069298] [ENSMUST00000160455] [ENSMUST00000162004] [ENSMUST00000162061] [ENSMUST00000162061]
Predicted Effect probably null
Transcript: ENSMUST00000026194
SMART Domains Protein: ENSMUSP00000026194
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026194
SMART Domains Protein: ENSMUSP00000026194
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069298
SMART Domains Protein: ENSMUSP00000071069
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069298
SMART Domains Protein: ENSMUSP00000071069
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159974
Predicted Effect probably null
Transcript: ENSMUST00000160455
SMART Domains Protein: ENSMUSP00000125662
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161761
Predicted Effect probably null
Transcript: ENSMUST00000162004
SMART Domains Protein: ENSMUSP00000125226
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162061
SMART Domains Protein: ENSMUSP00000124209
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162061
SMART Domains Protein: ENSMUSP00000124209
Gene: ENSMUSG00000025188

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is a component of three different protein complexes termed biogenesis of lysosome-related organelles complex (BLOC)-3, BLOC4, and BLOC5. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 1. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on chromosome 22. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit hypopigmentation and increased bleeding time. Impaired natural killer cell function, reduced secretion of kidney lysosomal enzymes,and abnormal retinofugal neuronal projections characterize some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dgcr8 A T 16: 18,259,979 Y597N probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Hps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hps1 APN 19 42771129 nonsense probably null
IGL02327:Hps1 APN 19 42756345 unclassified probably benign
IGL02488:Hps1 APN 19 42757788 unclassified probably benign
IGL03161:Hps1 APN 19 42767271 missense probably damaging 1.00
R0127:Hps1 UTSW 19 42771111 splice site probably benign
R0134:Hps1 UTSW 19 42766180 missense probably damaging 0.98
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0394:Hps1 UTSW 19 42770899 splice site probably null
R1435:Hps1 UTSW 19 42762275 missense probably benign 0.04
R1537:Hps1 UTSW 19 42759704 critical splice donor site probably null
R1616:Hps1 UTSW 19 42767185 missense probably damaging 1.00
R1860:Hps1 UTSW 19 42762449 missense probably damaging 1.00
R2014:Hps1 UTSW 19 42762512 missense probably benign 0.00
R3424:Hps1 UTSW 19 42760513 missense possibly damaging 0.75
R4472:Hps1 UTSW 19 42762496 missense probably damaging 1.00
R6054:Hps1 UTSW 19 42770778 missense probably damaging 0.96
R6275:Hps1 UTSW 19 42769607 missense probably null 1.00
R6807:Hps1 UTSW 19 42770778 missense possibly damaging 0.60
R6916:Hps1 UTSW 19 42766725
R7332:Hps1 UTSW 19 42777912 intron probably null
R7487:Hps1 UTSW 19 42756261 missense probably damaging 1.00
R7504:Hps1 UTSW 19 42766720 missense probably benign 0.00
R7823:Hps1 UTSW 19 42755707 missense possibly damaging 0.58
Z1176:Hps1 UTSW 19 42766686 missense probably null 0.00
Z1177:Hps1 UTSW 19 42755696 missense probably benign 0.00
Z1177:Hps1 UTSW 19 42759831 missense probably damaging 1.00
Z1177:Hps1 UTSW 19 42766218 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAAACTCTCACCCGGAATTCAG -3'
(R):5'- GACAGGAACCTTGGATTGGG -3'

Sequencing Primer
(F):5'- GGAATTCAGTTGCTCACCATGGAAC -3'
(R):5'- GGCCGGACAAGACCAACTTTC -3'
Posted On2016-10-06