Incidental Mutation 'R5477:Slc39a12'
ID434105
Institutional Source Beutler Lab
Gene Symbol Slc39a12
Ensembl Gene ENSMUSG00000036949
Gene Namesolute carrier family 39 (zinc transporter), member 12
SynonymsLOC277468
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location14388316-14494977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14389382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 21 (V21A)
Ref Sequence ENSEMBL: ENSMUSP00000122795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082290] [ENSMUST00000114731] [ENSMUST00000133258]
Predicted Effect probably benign
Transcript: ENSMUST00000082290
AA Change: V21A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080911
Gene: ENSMUSG00000036949
AA Change: V21A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zip 364 681 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114731
AA Change: V21A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110379
Gene: ENSMUSG00000036949
AA Change: V21A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Zip 382 511 2.5e-17 PFAM
Pfam:Zip 492 661 1.5e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133258
AA Change: V21A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122795
Gene: ENSMUSG00000036949
AA Change: V21A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Slc39a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Slc39a12 APN 2 14396068 splice site probably benign
IGL01597:Slc39a12 APN 2 14434309 missense possibly damaging 0.95
IGL02516:Slc39a12 APN 2 14400335 missense probably damaging 1.00
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0453:Slc39a12 UTSW 2 14435681 missense probably benign 0.04
R0533:Slc39a12 UTSW 2 14400331 missense probably benign 0.00
R0718:Slc39a12 UTSW 2 14407426 splice site probably benign
R1647:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1648:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1879:Slc39a12 UTSW 2 14444057 missense probably benign
R1993:Slc39a12 UTSW 2 14434219 missense probably damaging 0.98
R2429:Slc39a12 UTSW 2 14405086 missense probably benign 0.06
R3746:Slc39a12 UTSW 2 14396067 splice site probably benign
R3934:Slc39a12 UTSW 2 14434363 splice site probably benign
R3941:Slc39a12 UTSW 2 14396181 missense possibly damaging 0.95
R4008:Slc39a12 UTSW 2 14452117 missense probably damaging 1.00
R4478:Slc39a12 UTSW 2 14420179 nonsense probably null
R4622:Slc39a12 UTSW 2 14400325 missense probably benign 0.11
R4760:Slc39a12 UTSW 2 14400323 missense probably benign 0.14
R5566:Slc39a12 UTSW 2 14407603 missense possibly damaging 0.80
R5725:Slc39a12 UTSW 2 14389264 start gained probably benign
R5798:Slc39a12 UTSW 2 14449826 missense probably damaging 1.00
R6074:Slc39a12 UTSW 2 14407479 nonsense probably null
R6169:Slc39a12 UTSW 2 14400233 missense possibly damaging 0.64
R6180:Slc39a12 UTSW 2 14396127 missense probably benign 0.38
R6802:Slc39a12 UTSW 2 14420085 missense probably benign 0.28
R6847:Slc39a12 UTSW 2 14449917 missense probably damaging 1.00
R6899:Slc39a12 UTSW 2 14389541 missense probably damaging 1.00
R6931:Slc39a12 UTSW 2 14389375 missense probably benign 0.04
R7131:Slc39a12 UTSW 2 14449803 missense probably damaging 1.00
R7343:Slc39a12 UTSW 2 14452000 missense probably damaging 1.00
R7525:Slc39a12 UTSW 2 14494461 missense probably benign 0.01
R7568:Slc39a12 UTSW 2 14400128 splice site probably null
R7684:Slc39a12 UTSW 2 14449859 missense probably damaging 0.99
R7761:Slc39a12 UTSW 2 14434330 missense probably benign 0.01
R7785:Slc39a12 UTSW 2 14420218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCCTGTTGCTGCAAATC -3'
(R):5'- TTCTCTGTGGACACCCAGTC -3'

Sequencing Primer
(F):5'- CAGGCACCCAATTAGTGAGTCATTTC -3'
(R):5'- CCTCTCCAACAGAATTTTGATGAGGC -3'
Posted On2016-10-06