Incidental Mutation 'R5477:Sycp1'
ID434109
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102818890 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 973 (W973R)
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
Predicted Effect probably damaging
Transcript: ENSMUST00000029448
AA Change: W973R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: W973R

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196988
AA Change: W973R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: W973R

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198651
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATTAACTATTCAGAGACCCTCAC -3'
(R):5'- GCCTGGTTTCAGAGGAAGATG -3'

Sequencing Primer
(F):5'- CTTCGAACTTCAATATCCATTGCAAG -3'
(R):5'- TGGTTTCAGAGGAAGATGTATCAAAC -3'
Posted On2016-10-06