Incidental Mutation 'R5477:Olfr1347'
ID434114
Institutional Source Beutler Lab
Gene Symbol Olfr1347
Ensembl Gene ENSMUSG00000034583
Gene Nameolfactory receptor 1347
SynonymsMOR103-11, MOR103-19_i, GA_x6K02T2QGBW-3218686-3217748
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6486944-6499755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6488571 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 94 (Y94C)
Ref Sequence ENSEMBL: ENSMUSP00000146605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036357] [ENSMUST00000086318] [ENSMUST00000207339] [ENSMUST00000209055] [ENSMUST00000209866] [ENSMUST00000220413]
AlphaFold Q8VF33
Predicted Effect probably benign
Transcript: ENSMUST00000036357
AA Change: Y94C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046590
Gene: ENSMUSG00000034583
AA Change: Y94C

DomainStartEndE-ValueType
Pfam:7tm_4 42 318 2.5e-50 PFAM
Pfam:7tm_1 52 301 2.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086318
SMART Domains Protein: ENSMUSP00000083498
Gene: ENSMUSG00000096228

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.1e-50 PFAM
Pfam:7tm_1 45 294 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207339
AA Change: Y94C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209055
AA Change: Y94C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000209866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218572
Predicted Effect probably benign
Transcript: ENSMUST00000220413
AA Change: Y101C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Olfr1347
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02395:Olfr1347 APN 7 6488803 missense possibly damaging 0.83
R0277:Olfr1347 UTSW 7 6488434 missense probably benign 0.00
R0891:Olfr1347 UTSW 7 6488472 missense probably damaging 1.00
R1394:Olfr1347 UTSW 7 6488362 missense probably damaging 1.00
R1395:Olfr1347 UTSW 7 6488362 missense probably damaging 1.00
R1503:Olfr1347 UTSW 7 6488179 missense probably damaging 1.00
R3014:Olfr1347 UTSW 7 6488471 nonsense probably null
R5194:Olfr1347 UTSW 7 6488520 missense probably damaging 1.00
R6137:Olfr1347 UTSW 7 6488845 missense probably benign 0.02
R6212:Olfr1347 UTSW 7 6488368 splice site probably null
R6706:Olfr1347 UTSW 7 6488050 missense probably damaging 1.00
R7444:Olfr1347 UTSW 7 6487920 missense probably benign 0.00
Z1176:Olfr1347 UTSW 7 6488692 missense probably benign 0.00
Z1176:Olfr1347 UTSW 7 6488698 missense probably damaging 0.98
Z1177:Olfr1347 UTSW 7 6488204 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGCTTGCAATGCATTTTGTC -3'
(R):5'- TGAGTCTCTACCTGCTGACC -3'

Sequencing Primer
(F):5'- TGTCTTTATCGCCGAGACCACAAG -3'
(R):5'- TGCTGACCCTCCTGGAGAAC -3'
Posted On2016-10-06