Incidental Mutation 'R5477:Trim30d'
ID434116
Institutional Source Beutler Lab
Gene Symbol Trim30d
Ensembl Gene ENSMUSG00000057596
Gene Nametripartite motif-containing 30D
SynonymsTrim79, TRIM30-3
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104470014-104507849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104472140 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 316 (Y316F)
Ref Sequence ENSEMBL: ENSMUSP00000065020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033211] [ENSMUST00000071069]
Predicted Effect probably damaging
Transcript: ENSMUST00000033211
AA Change: Y466F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033211
Gene: ENSMUSG00000057596
AA Change: Y466F

DomainStartEndE-ValueType
RING 15 58 1.72e-8 SMART
BBOX 91 132 5.25e-13 SMART
low complexity region 196 228 N/A INTRINSIC
Pfam:SPRY 350 491 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071069
AA Change: Y316F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065020
Gene: ENSMUSG00000057596
AA Change: Y316F

DomainStartEndE-ValueType
coiled coil region 23 84 N/A INTRINSIC
Pfam:SPRY 198 346 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141063
SMART Domains Protein: ENSMUSP00000115684
Gene: ENSMUSG00000057596

DomainStartEndE-ValueType
PDB:4B3N|B 58 197 3e-19 PDB
Blast:SPRY 122 209 4e-13 BLAST
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Trim30d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Trim30d APN 7 104472126 missense possibly damaging 0.81
IGL01818:Trim30d APN 7 104472060 missense probably damaging 1.00
IGL02552:Trim30d APN 7 104472416 missense probably damaging 0.98
IGL03000:Trim30d APN 7 104473269 missense probably benign 0.26
R0608:Trim30d UTSW 7 104472485 missense probably damaging 0.99
R0629:Trim30d UTSW 7 104487655 missense probably damaging 1.00
R1390:Trim30d UTSW 7 104483403 missense probably benign 0.41
R1460:Trim30d UTSW 7 104472104 missense probably benign 0.00
R1474:Trim30d UTSW 7 104472494 missense probably damaging 1.00
R1701:Trim30d UTSW 7 104484182 nonsense probably null
R1799:Trim30d UTSW 7 104483475 missense probably damaging 0.98
R2295:Trim30d UTSW 7 104487942 missense probably damaging 1.00
R3898:Trim30d UTSW 7 104483529 missense probably benign 0.01
R3953:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3954:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3955:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3957:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R4086:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4087:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4089:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4580:Trim30d UTSW 7 104472558 missense possibly damaging 0.68
R4596:Trim30d UTSW 7 104472526 missense probably benign 0.02
R4926:Trim30d UTSW 7 104483357 missense probably benign 0.09
R5071:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5074:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5294:Trim30d UTSW 7 104472488 missense probably damaging 1.00
R5629:Trim30d UTSW 7 104487929 missense possibly damaging 0.87
R5743:Trim30d UTSW 7 104472328 nonsense probably null
R6178:Trim30d UTSW 7 104487995 start codon destroyed probably damaging 1.00
R6244:Trim30d UTSW 7 104487610 missense probably damaging 1.00
R6937:Trim30d UTSW 7 104483427 missense probably damaging 1.00
R7014:Trim30d UTSW 7 104483336 missense probably benign 0.01
R7323:Trim30d UTSW 7 104483348 missense probably benign 0.41
X0026:Trim30d UTSW 7 104487965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCACAGTGGTTTGGGATTAG -3'
(R):5'- CAGCCTAAATGTGGCTACTGG -3'

Sequencing Primer
(F):5'- AGGTCATTACAATAAAGGGCCC -3'
(R):5'- CCTAAATGTGGCTACTGGGTTATAG -3'
Posted On2016-10-06