Mutagenetix > Incidental Mutation

Incidental Mutation 'R5477:Aff4'

434124

Institutional Source

Beutler Lab

Gene Symbol

Aff4

Ensembl Gene

ENSMUSG00000049470

Gene Name

AF4/FMR2 family, member 4

Synonyms

Laf4l, Alf4

MMRRC Submission

043038-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5477 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53350833-53421830 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 53408472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060945]

AlphaFold

Q9ESC8

Predicted Effect

probably null
Transcript: ENSMUST00000060945

SMART Domains

Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470

Domain	Start	End	E-Value	Type
Pfam:AF-4	2	1156	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129019

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154499

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195888

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
9930021J03Rik	A	G	19: 29,754,118	V498A	probably benign	Het
Aacs	T	C	5: 125,511,920	Y421H	probably damaging	Het
Abca13	A	G	11: 9,301,298	K2890R	possibly damaging	Het
Cntn4	A	T	6: 106,673,950	Q698L	possibly damaging	Het
D5Ertd579e	G	T	5: 36,615,257	S598Y	probably damaging	Het
Dmrt1	A	G	19: 25,509,800	M157V	probably benign	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Gm10521	T	A	1: 171,896,500	M126K	unknown	Het
Hs2st1	A	G	3: 144,556,948		probably benign	Het
Lats2	T	C	14: 57,699,553	D113G	probably benign	Het
Myo15	A	C	11: 60,477,677	D421A	probably damaging	Het
Olfr1347	T	C	7: 6,488,571	Y94C	probably benign	Het
Olfr178	T	A	16: 58,889,744	I159F	probably benign	Het
Olfr181	A	T	16: 58,926,030	D180E	possibly damaging	Het
Pappa2	T	A	1: 158,956,738	D234V	probably benign	Het
Parl	G	T	16: 20,280,074	T311K	possibly damaging	Het
Pias3	G	A	3: 96,705,003	R557H	probably damaging	Het
Pskh1	C	T	8: 105,929,879	R396C	probably damaging	Het
Rc3h2	T	C	2: 37,399,630	D390G	possibly damaging	Het
Ryr2	G	T	13: 11,705,656	P2702Q	probably damaging	Het
Senp6	C	A	9: 80,143,843	A961D	probably damaging	Het
Slc27a3	A	G	3: 90,386,839	S503P	probably benign	Het
Slc39a12	T	C	2: 14,389,382	V21A	possibly damaging	Het
Sox7	A	G	14: 63,948,496	Y327C	probably damaging	Het
Spdl1	A	T	11: 34,822,210	F288I	possibly damaging	Het
Ssbp2	T	A	13: 91,664,125	M127K	probably damaging	Het
Sspo	A	C	6: 48,498,393	S5032R	possibly damaging	Het
Sycp1	A	T	3: 102,818,890	W973R	probably damaging	Het
Tm4sf5	C	T	11: 70,510,348	T130I	probably benign	Het
Top2a	T	A	11: 99,016,480	K175*	probably null	Het
Trim30d	T	A	7: 104,472,140	Y316F	probably damaging	Het
Vmn1r124	G	A	7: 21,259,728	P297L	probably damaging	Het
Zfp715	T	C	7: 43,299,954	Y194C	probably damaging	Het

Other mutations in Aff4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Aff4	APN	11	53411990	missense	probably damaging	0.98
IGL01348:Aff4	APN	11	53402500	missense	probably benign
IGL01446:Aff4	APN	11	53415469	missense	probably damaging	0.99
IGL02151:Aff4	APN	11	53399806	missense	probably benign
IGL02526:Aff4	APN	11	53406682	splice site	probably benign
IGL02567:Aff4	APN	11	53372751	missense	possibly damaging	0.64
IGL02633:Aff4	APN	11	53409371	splice site	probably benign
IGL02707:Aff4	APN	11	53399740	missense	probably benign
R0090:Aff4	UTSW	11	53392782	missense	probably benign	0.01
R0128:Aff4	UTSW	11	53415466	missense	probably damaging	0.99
R0243:Aff4	UTSW	11	53397858	missense	possibly damaging	0.74
R0345:Aff4	UTSW	11	53372881	missense	probably benign	0.00
R0347:Aff4	UTSW	11	53400088	missense	probably benign	0.01
R0732:Aff4	UTSW	11	53375596	missense	probably benign
R0737:Aff4	UTSW	11	53410953	nonsense	probably null
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1500:Aff4	UTSW	11	53372378	missense	probably benign	0.00
R1693:Aff4	UTSW	11	53396553	missense	probably damaging	1.00
R1743:Aff4	UTSW	11	53368695	missense	possibly damaging	0.65
R1961:Aff4	UTSW	11	53372999	missense	probably damaging	1.00
R2048:Aff4	UTSW	11	53398385	missense	probably benign	0.39
R2138:Aff4	UTSW	11	53372512	missense	possibly damaging	0.94
R2155:Aff4	UTSW	11	53399619	missense	probably damaging	1.00
R2379:Aff4	UTSW	11	53408478	splice site	probably benign
R4156:Aff4	UTSW	11	53410899	intron	probably benign
R5001:Aff4	UTSW	11	53404357	missense	probably damaging	1.00
R5281:Aff4	UTSW	11	53372288	missense	probably damaging	1.00
R5677:Aff4	UTSW	11	53400275	missense	possibly damaging	0.55
R5992:Aff4	UTSW	11	53373010	missense	probably damaging	0.99
R6576:Aff4	UTSW	11	53400441	missense	probably damaging	1.00
R6764:Aff4	UTSW	11	53399830	missense	probably damaging	1.00
R6988:Aff4	UTSW	11	53398237	missense	probably damaging	1.00
R7034:Aff4	UTSW	11	53408409	missense	probably damaging	0.99
R7177:Aff4	UTSW	11	53406639	missense	probably benign	0.10
R7426:Aff4	UTSW	11	53372875	missense	probably damaging	1.00
R7755:Aff4	UTSW	11	53398379	missense	probably damaging	0.97
R7848:Aff4	UTSW	11	53404512	missense	probably benign	0.05
R7968:Aff4	UTSW	11	53409348	missense	probably damaging	1.00
R8159:Aff4	UTSW	11	53411894	missense	possibly damaging	0.71
R8218:Aff4	UTSW	11	53398257	missense	probably damaging	0.98
R8241:Aff4	UTSW	11	53400171	missense	probably benign	0.00
R8284:Aff4	UTSW	11	53404552	missense	probably damaging	0.99
R8373:Aff4	UTSW	11	53400267	nonsense	probably null
R8695:Aff4	UTSW	11	53368682	missense	probably damaging	1.00
R8777:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8777-TAIL:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8780:Aff4	UTSW	11	53380617	missense	probably damaging	1.00
R8798:Aff4	UTSW	11	53400508	critical splice donor site	probably benign
R8838:Aff4	UTSW	11	53406638	missense	possibly damaging	0.77
R8939:Aff4	UTSW	11	53372404	missense	probably benign
R9146:Aff4	UTSW	11	53408136	missense	probably benign	0.06
R9329:Aff4	UTSW	11	53397859	missense	probably damaging	1.00
R9378:Aff4	UTSW	11	53372479	missense	probably damaging	0.98
R9471:Aff4	UTSW	11	53380646	missense	probably benign	0.13
R9779:Aff4	UTSW	11	53372907	nonsense	probably null
R9796:Aff4	UTSW	11	53411997	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACACGGTGGAGCTCATTAAG -3'
(R):5'- AGCACATTCATCAAGAGGGC -3'

Sequencing Primer
(F):5'- GCTCATTAAGTAAGTGGGGACTATC -3'
(R):5'- CACATTCATCAAGAGGGCACTGG -3'

Posted On

2016-10-06