Incidental Mutation 'R5477:Aff4'
ID434124
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene NameAF4/FMR2 family, member 4
SynonymsLaf4l, Alf4
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53350833-53421830 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 53408472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
Predicted Effect probably null
Transcript: ENSMUST00000060945
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195888
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACGGTGGAGCTCATTAAG -3'
(R):5'- AGCACATTCATCAAGAGGGC -3'

Sequencing Primer
(F):5'- GCTCATTAAGTAAGTGGGGACTATC -3'
(R):5'- CACATTCATCAAGAGGGCACTGG -3'
Posted On2016-10-06