Incidental Mutation 'R5477:Top2a'
ID434128
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission 043038-MU
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 99016480 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 175 (K175*)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect probably null
Transcript: ENSMUST00000068031
AA Change: K175*
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: K175*

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139730
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R8122:Top2a UTSW 11 98999167 missense probably benign
R8260:Top2a UTSW 11 99000769 missense probably null 0.87
R8504:Top2a UTSW 11 99014741 missense probably benign
R8550:Top2a UTSW 11 98995918 missense probably benign
R8558:Top2a UTSW 11 99021723 missense probably damaging 1.00
R8693:Top2a UTSW 11 99010042 missense probably damaging 1.00
R8851:Top2a UTSW 11 99009851 missense probably damaging 1.00
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ATCCATCCACGTCTATGGCAG -3'
(R):5'- CTGCCTGTGTAACCTGTAAGAG -3'

Sequencing Primer
(F):5'- TCCACGTCTATGGCAGTAAAG -3'
(R):5'- CCTGTGTAACCTGTAAGAGAGATTTG -3'
Posted On2016-10-06