Incidental Mutation 'R5477:Sox7'
ID434132
Institutional Source Beutler Lab
Gene Symbol Sox7
Ensembl Gene ENSMUSG00000063060
Gene NameSRY (sex determining region Y)-box 7
Synonyms
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63943673-63950732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63948496 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 327 (Y327C)
Ref Sequence ENSEMBL: ENSMUSP00000078597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079652]
AlphaFold P40646
Predicted Effect probably damaging
Transcript: ENSMUST00000079652
AA Change: Y327C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078597
Gene: ENSMUSG00000063060
AA Change: Y327C

DomainStartEndE-ValueType
HMG 44 114 8.74e-27 SMART
Pfam:Sox_C_TAD 171 378 1.4e-58 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a knock-out allele exhibit embryonic growth retardation, abnormal vitelline vascular remodeling and pericardial edema, and die during organogenesis. Depending on the genetic background, a portion of heterozygotes can develop congenital retrosternal diaphragmatic hernias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Sox7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sox7 APN 14 63948187 missense probably benign 0.00
R0378:Sox7 UTSW 14 63943949 missense probably damaging 0.99
R3147:Sox7 UTSW 14 63948634 missense probably damaging 1.00
R4350:Sox7 UTSW 14 63948546 missense probably benign 0.02
R4899:Sox7 UTSW 14 63948478 missense probably damaging 1.00
R5217:Sox7 UTSW 14 63948000 missense probably damaging 0.97
R5418:Sox7 UTSW 14 63947947 missense probably benign 0.30
R6603:Sox7 UTSW 14 63948188 missense probably benign 0.06
R7216:Sox7 UTSW 14 63947989 missense probably benign 0.42
R7312:Sox7 UTSW 14 63947842 missense probably damaging 1.00
R7812:Sox7 UTSW 14 63948232 missense probably benign 0.09
R8310:Sox7 UTSW 14 63943826 missense probably benign 0.03
R8716:Sox7 UTSW 14 63948588 missense probably benign 0.00
Z1177:Sox7 UTSW 14 63947865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCAGGGGTTTCTATGATGTCC -3'
(R):5'- CTCAGTGCTTCATAGGGAGG -3'

Sequencing Primer
(F):5'- ATGATGTCCTCTGTTTCTGGATGTCC -3'
(R):5'- TGGGCCAGGCTCCATTC -3'
Posted On2016-10-06