Incidental Mutation 'R5477:Olfr181'
ID434135
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission 043038-MU
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58926030 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 180 (D180E)
Ref Sequence ENSEMBL: ENSMUSP00000145877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075361
AA Change: D180E

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: D180E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
Predicted Effect possibly damaging
Transcript: ENSMUST00000205742
AA Change: D180E

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205986
AA Change: D180E

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214942
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGGTCCAATATACATGAGAAGAC -3'
(R):5'- TGGCCATATGCAACCCTCTG -3'

Sequencing Primer
(F):5'- TGGGATGCACAGGTAGAAAATGC -3'
(R):5'- TCTGCAGTACCACACCATGATGTC -3'
Posted On2016-10-06