Incidental Mutation 'R5478:Fastkd2'
ID 434139
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 043039-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5478 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63730614-63754655 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63739186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 406 (I406T)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: I406T

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: I406T

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148758
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,839,465 probably benign Het
Adamts2 T C 11: 50,792,651 V920A possibly damaging Het
Alpk1 A G 3: 127,677,719 V1038A probably damaging Het
Amotl1 A G 9: 14,592,752 probably null Het
Apba2 T A 7: 64,695,186 Y41* probably null Het
BC048562 G A 9: 108,445,164 probably benign Het
Braf A G 6: 39,677,574 L86P possibly damaging Het
Capn3 A G 2: 120,464,185 probably null Het
Carmil1 T C 13: 24,112,045 D371G probably damaging Het
Cdhr4 G A 9: 107,995,591 V280I possibly damaging Het
Cdkl2 T A 5: 92,039,249 K53* probably null Het
Chl1 A T 6: 103,683,221 E353D probably damaging Het
Col4a2 T A 8: 11,398,697 N72K probably benign Het
Comtd1 A T 14: 21,848,913 probably benign Het
Ctsm A T 13: 61,537,729 S290T probably benign Het
Defa35 A T 8: 21,065,820 Y65F probably benign Het
Dock8 T A 19: 25,079,822 C198S probably benign Het
Epha3 A C 16: 63,583,533 M734R probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Gm16686 A T 4: 88,755,477 probably benign Het
Gm4922 T C 10: 18,784,137 E279G probably benign Het
Gm5709 A T 3: 59,635,674 noncoding transcript Het
Grin3a C A 4: 49,792,481 M417I probably benign Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hrasls5 A C 19: 7,614,671 probably benign Het
Idh1 A T 1: 65,161,838 M318K probably benign Het
Krt222 A G 11: 99,234,948 S286P probably damaging Het
Mmrn2 A T 14: 34,396,582 T142S probably benign Het
Myocd G T 11: 65,233,088 probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Olfr183 A T 16: 59,000,062 I126L possibly damaging Het
Olfr598 T C 7: 103,328,825 L113P probably damaging Het
Pcdhgc4 C T 18: 37,817,322 T597M probably damaging Het
Pdrg1 A G 2: 153,015,232 probably benign Het
Per2 T A 1: 91,432,868 I521F probably benign Het
Pkhd1 G A 1: 20,201,156 L3058F probably damaging Het
Pnliprp1 A T 19: 58,734,991 probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prpf18 A T 2: 4,638,894 N155K probably benign Het
Pum1 T A 4: 130,751,484 N472K possibly damaging Het
Reln A T 5: 22,004,203 S1126T probably benign Het
Rnase11 A G 14: 51,049,875 L74P probably damaging Het
Slc25a23 T A 17: 57,052,780 I324F probably damaging Het
Slc26a10 C A 10: 127,173,949 R576L probably benign Het
Slc4a1 T A 11: 102,350,314 E921D probably damaging Het
Slc9c1 A T 16: 45,554,246 M296L probably damaging Het
Sos1 T C 17: 80,433,847 D503G probably damaging Het
Srpk2 G A 5: 23,524,183 T486I possibly damaging Het
Sult6b1 A T 17: 78,894,672 probably null Het
Tbc1d16 T C 11: 119,155,091 E509G probably benign Het
Tktl2 T C 8: 66,513,398 V536A probably damaging Het
Ugt2b36 A T 5: 87,089,482 V188D probably damaging Het
Veph1 T C 3: 66,255,022 T72A probably damaging Het
Vmn2r73 A T 7: 85,869,788 I542N probably damaging Het
Vps13d G A 4: 145,167,550 P480S probably damaging Het
Zfp319 A G 8: 95,325,565 probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63735460 splice site probably null
R8263:Fastkd2 UTSW 1 63731809 missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63748024 missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63747979 missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63731764 missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63735921 missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCAGGTGTGTCATATGAAAGGC -3'
(R):5'- CGTGTGACGTCATGTAAGGG -3'

Sequencing Primer
(F):5'- ATGTCTTGGTTCTCAGCTTAGAAAG -3'
(R):5'- GGAAACCATACGTACTCTCTGTTGTG -3'
Posted On 2016-10-06