Incidental Mutation 'R5478:Fastkd2'
ID 434139
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 043039-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5478 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63769758-63792544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63778345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 406 (I406T)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: I406T

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: I406T

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148758
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,827,904 (GRCm39) probably benign Het
Adamts2 T C 11: 50,683,478 (GRCm39) V920A possibly damaging Het
Alpk1 A G 3: 127,471,368 (GRCm39) V1038A probably damaging Het
Amotl1 A G 9: 14,504,048 (GRCm39) probably null Het
Apba2 T A 7: 64,344,934 (GRCm39) Y41* probably null Het
BC048562 G A 9: 108,322,363 (GRCm39) probably benign Het
Braf A G 6: 39,654,508 (GRCm39) L86P possibly damaging Het
Capn3 A G 2: 120,294,666 (GRCm39) probably null Het
Carmil1 T C 13: 24,296,028 (GRCm39) D371G probably damaging Het
Cdhr4 G A 9: 107,872,790 (GRCm39) V280I possibly damaging Het
Cdkl2 T A 5: 92,187,108 (GRCm39) K53* probably null Het
Chl1 A T 6: 103,660,182 (GRCm39) E353D probably damaging Het
Col4a2 T A 8: 11,448,697 (GRCm39) N72K probably benign Het
Comtd1 A T 14: 21,898,981 (GRCm39) probably benign Het
Ctsm A T 13: 61,685,543 (GRCm39) S290T probably benign Het
Defa35 A T 8: 21,555,836 (GRCm39) Y65F probably benign Het
Dock8 T A 19: 25,057,186 (GRCm39) C198S probably benign Het
Epha3 A C 16: 63,403,896 (GRCm39) M734R probably damaging Het
Fshr C T 17: 89,309,143 (GRCm39) V222I probably benign Het
Gm16686 A T 4: 88,673,714 (GRCm39) probably benign Het
Gm4922 T C 10: 18,659,885 (GRCm39) E279G probably benign Het
Gm5709 A T 3: 59,543,095 (GRCm39) noncoding transcript Het
Grin3a C A 4: 49,792,481 (GRCm39) M417I probably benign Het
Hnf4a A T 2: 163,410,926 (GRCm39) M408L probably benign Het
Idh1 A T 1: 65,200,997 (GRCm39) M318K probably benign Het
Krt222 A G 11: 99,125,774 (GRCm39) S286P probably damaging Het
Mmrn2 A T 14: 34,118,539 (GRCm39) T142S probably benign Het
Myocd G T 11: 65,123,914 (GRCm39) probably null Het
Ncam2 C T 16: 81,231,766 (GRCm39) R77* probably null Het
Or52ab7 T C 7: 102,978,032 (GRCm39) L113P probably damaging Het
Or5h17 A T 16: 58,820,425 (GRCm39) I126L possibly damaging Het
Pcdhgc4 C T 18: 37,950,375 (GRCm39) T597M probably damaging Het
Pdrg1 A G 2: 152,857,152 (GRCm39) probably benign Het
Per2 T A 1: 91,360,590 (GRCm39) I521F probably benign Het
Pkhd1 G A 1: 20,271,380 (GRCm39) L3058F probably damaging Het
Plaat5 A C 19: 7,592,036 (GRCm39) probably benign Het
Pnliprp1 A T 19: 58,723,423 (GRCm39) probably null Het
Ppargc1b T A 18: 61,440,639 (GRCm39) M744L probably benign Het
Prpf18 A T 2: 4,643,705 (GRCm39) N155K probably benign Het
Pum1 T A 4: 130,478,795 (GRCm39) N472K possibly damaging Het
Reln A T 5: 22,209,201 (GRCm39) S1126T probably benign Het
Rnase11 A G 14: 51,287,332 (GRCm39) L74P probably damaging Het
Slc25a23 T A 17: 57,359,780 (GRCm39) I324F probably damaging Het
Slc26a10 C A 10: 127,009,818 (GRCm39) R576L probably benign Het
Slc4a1 T A 11: 102,241,140 (GRCm39) E921D probably damaging Het
Slc9c1 A T 16: 45,374,609 (GRCm39) M296L probably damaging Het
Sos1 T C 17: 80,741,276 (GRCm39) D503G probably damaging Het
Srpk2 G A 5: 23,729,181 (GRCm39) T486I possibly damaging Het
Sult6b1 A T 17: 79,202,101 (GRCm39) probably null Het
Tbc1d16 T C 11: 119,045,917 (GRCm39) E509G probably benign Het
Tktl2 T C 8: 66,966,050 (GRCm39) V536A probably damaging Het
Ugt2b36 A T 5: 87,237,341 (GRCm39) V188D probably damaging Het
Veph1 T C 3: 66,162,443 (GRCm39) T72A probably damaging Het
Vmn2r73 A T 7: 85,518,996 (GRCm39) I542N probably damaging Het
Vps13d G A 4: 144,894,120 (GRCm39) P480S probably damaging Het
Zfp319 A G 8: 96,052,193 (GRCm39) probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63,776,930 (GRCm39) splice site probably benign
IGL01890:Fastkd2 APN 1 63,771,320 (GRCm39) missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63,787,158 (GRCm39) missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63,777,083 (GRCm39) splice site probably benign
IGL03208:Fastkd2 APN 1 63,778,365 (GRCm39) missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63,771,187 (GRCm39) missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63,791,559 (GRCm39) missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63,776,970 (GRCm39) missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63,791,499 (GRCm39) missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63,787,114 (GRCm39) splice site probably benign
R1468:Fastkd2 UTSW 1 63,771,385 (GRCm39) unclassified probably benign
R1579:Fastkd2 UTSW 1 63,785,046 (GRCm39) missense probably null 0.00
R1729:Fastkd2 UTSW 1 63,790,459 (GRCm39) nonsense probably null
R3937:Fastkd2 UTSW 1 63,776,995 (GRCm39) missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63,774,968 (GRCm39) intron probably benign
R4473:Fastkd2 UTSW 1 63,770,833 (GRCm39) missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63,785,045 (GRCm39) missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63,789,055 (GRCm39) intron probably benign
R5176:Fastkd2 UTSW 1 63,770,598 (GRCm39) unclassified probably benign
R5619:Fastkd2 UTSW 1 63,778,469 (GRCm39) missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63,770,953 (GRCm39) missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63,771,032 (GRCm39) missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63,771,009 (GRCm39) missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63,776,948 (GRCm39) missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63,770,851 (GRCm39) missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63,774,619 (GRCm39) splice site probably null
R8263:Fastkd2 UTSW 1 63,770,968 (GRCm39) missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63,787,183 (GRCm39) missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63,787,138 (GRCm39) missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63,770,923 (GRCm39) missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63,775,080 (GRCm39) missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63,773,996 (GRCm39) critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63,773,995 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCAGGTGTGTCATATGAAAGGC -3'
(R):5'- CGTGTGACGTCATGTAAGGG -3'

Sequencing Primer
(F):5'- ATGTCTTGGTTCTCAGCTTAGAAAG -3'
(R):5'- GGAAACCATACGTACTCTCTGTTGTG -3'
Posted On 2016-10-06