Incidental Mutation 'R5478:Slc4a1'
ID 434175
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 043039-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5478 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102241140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 921 (E921D)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect probably damaging
Transcript: ENSMUST00000006749
AA Change: E921D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: E921D

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Meta Mutation Damage Score 0.2259 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,827,904 (GRCm39) probably benign Het
Adamts2 T C 11: 50,683,478 (GRCm39) V920A possibly damaging Het
Alpk1 A G 3: 127,471,368 (GRCm39) V1038A probably damaging Het
Amotl1 A G 9: 14,504,048 (GRCm39) probably null Het
Apba2 T A 7: 64,344,934 (GRCm39) Y41* probably null Het
BC048562 G A 9: 108,322,363 (GRCm39) probably benign Het
Braf A G 6: 39,654,508 (GRCm39) L86P possibly damaging Het
Capn3 A G 2: 120,294,666 (GRCm39) probably null Het
Carmil1 T C 13: 24,296,028 (GRCm39) D371G probably damaging Het
Cdhr4 G A 9: 107,872,790 (GRCm39) V280I possibly damaging Het
Cdkl2 T A 5: 92,187,108 (GRCm39) K53* probably null Het
Chl1 A T 6: 103,660,182 (GRCm39) E353D probably damaging Het
Col4a2 T A 8: 11,448,697 (GRCm39) N72K probably benign Het
Comtd1 A T 14: 21,898,981 (GRCm39) probably benign Het
Ctsm A T 13: 61,685,543 (GRCm39) S290T probably benign Het
Defa35 A T 8: 21,555,836 (GRCm39) Y65F probably benign Het
Dock8 T A 19: 25,057,186 (GRCm39) C198S probably benign Het
Epha3 A C 16: 63,403,896 (GRCm39) M734R probably damaging Het
Fastkd2 T C 1: 63,778,345 (GRCm39) I406T probably benign Het
Fshr C T 17: 89,309,143 (GRCm39) V222I probably benign Het
Gm16686 A T 4: 88,673,714 (GRCm39) probably benign Het
Gm4922 T C 10: 18,659,885 (GRCm39) E279G probably benign Het
Gm5709 A T 3: 59,543,095 (GRCm39) noncoding transcript Het
Grin3a C A 4: 49,792,481 (GRCm39) M417I probably benign Het
Hnf4a A T 2: 163,410,926 (GRCm39) M408L probably benign Het
Idh1 A T 1: 65,200,997 (GRCm39) M318K probably benign Het
Krt222 A G 11: 99,125,774 (GRCm39) S286P probably damaging Het
Mmrn2 A T 14: 34,118,539 (GRCm39) T142S probably benign Het
Myocd G T 11: 65,123,914 (GRCm39) probably null Het
Ncam2 C T 16: 81,231,766 (GRCm39) R77* probably null Het
Or52ab7 T C 7: 102,978,032 (GRCm39) L113P probably damaging Het
Or5h17 A T 16: 58,820,425 (GRCm39) I126L possibly damaging Het
Pcdhgc4 C T 18: 37,950,375 (GRCm39) T597M probably damaging Het
Pdrg1 A G 2: 152,857,152 (GRCm39) probably benign Het
Per2 T A 1: 91,360,590 (GRCm39) I521F probably benign Het
Pkhd1 G A 1: 20,271,380 (GRCm39) L3058F probably damaging Het
Plaat5 A C 19: 7,592,036 (GRCm39) probably benign Het
Pnliprp1 A T 19: 58,723,423 (GRCm39) probably null Het
Ppargc1b T A 18: 61,440,639 (GRCm39) M744L probably benign Het
Prpf18 A T 2: 4,643,705 (GRCm39) N155K probably benign Het
Pum1 T A 4: 130,478,795 (GRCm39) N472K possibly damaging Het
Reln A T 5: 22,209,201 (GRCm39) S1126T probably benign Het
Rnase11 A G 14: 51,287,332 (GRCm39) L74P probably damaging Het
Slc25a23 T A 17: 57,359,780 (GRCm39) I324F probably damaging Het
Slc26a10 C A 10: 127,009,818 (GRCm39) R576L probably benign Het
Slc9c1 A T 16: 45,374,609 (GRCm39) M296L probably damaging Het
Sos1 T C 17: 80,741,276 (GRCm39) D503G probably damaging Het
Srpk2 G A 5: 23,729,181 (GRCm39) T486I possibly damaging Het
Sult6b1 A T 17: 79,202,101 (GRCm39) probably null Het
Tbc1d16 T C 11: 119,045,917 (GRCm39) E509G probably benign Het
Tktl2 T C 8: 66,966,050 (GRCm39) V536A probably damaging Het
Ugt2b36 A T 5: 87,237,341 (GRCm39) V188D probably damaging Het
Veph1 T C 3: 66,162,443 (GRCm39) T72A probably damaging Het
Vmn2r73 A T 7: 85,518,996 (GRCm39) I542N probably damaging Het
Vps13d G A 4: 144,894,120 (GRCm39) P480S probably damaging Het
Zfp319 A G 8: 96,052,193 (GRCm39) probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTTGCAAGAGACTGTGACC -3'
(R):5'- CAACTCTGTACTCTAGGGACAGC -3'

Sequencing Primer
(F):5'- GAGACTGTGACCCCAATTCCCTG -3'
(R):5'- TACTCTAGGGACAGCAGGGC -3'
Posted On 2016-10-06