Incidental Mutation 'R5478:Rnase11'
ID434181
Institutional Source Beutler Lab
Gene Symbol Rnase11
Ensembl Gene ENSMUSG00000059648
Gene Nameribonuclease, RNase A family, 11 (non-active)
Synonyms
MMRRC Submission 043039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5478 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51049451-51050163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51049875 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 74 (L74P)
Ref Sequence ENSEMBL: ENSMUSP00000075472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076106]
Predicted Effect probably damaging
Transcript: ENSMUST00000076106
AA Change: L74P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075472
Gene: ENSMUSG00000059648
AA Change: L74P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,839,465 probably benign Het
Adamts2 T C 11: 50,792,651 V920A possibly damaging Het
Alpk1 A G 3: 127,677,719 V1038A probably damaging Het
Amotl1 A G 9: 14,592,752 probably null Het
Apba2 T A 7: 64,695,186 Y41* probably null Het
BC048562 G A 9: 108,445,164 probably benign Het
Braf A G 6: 39,677,574 L86P possibly damaging Het
Capn3 A G 2: 120,464,185 probably null Het
Carmil1 T C 13: 24,112,045 D371G probably damaging Het
Cdhr4 G A 9: 107,995,591 V280I possibly damaging Het
Cdkl2 T A 5: 92,039,249 K53* probably null Het
Chl1 A T 6: 103,683,221 E353D probably damaging Het
Col4a2 T A 8: 11,398,697 N72K probably benign Het
Comtd1 A T 14: 21,848,913 probably benign Het
Ctsm A T 13: 61,537,729 S290T probably benign Het
Defa35 A T 8: 21,065,820 Y65F probably benign Het
Dock8 T A 19: 25,079,822 C198S probably benign Het
Epha3 A C 16: 63,583,533 M734R probably damaging Het
Fastkd2 T C 1: 63,739,186 I406T probably benign Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Gm16686 A T 4: 88,755,477 probably benign Het
Gm4922 T C 10: 18,784,137 E279G probably benign Het
Gm5709 A T 3: 59,635,674 noncoding transcript Het
Grin3a C A 4: 49,792,481 M417I probably benign Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hrasls5 A C 19: 7,614,671 probably benign Het
Idh1 A T 1: 65,161,838 M318K probably benign Het
Krt222 A G 11: 99,234,948 S286P probably damaging Het
Mmrn2 A T 14: 34,396,582 T142S probably benign Het
Myocd G T 11: 65,233,088 probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Olfr183 A T 16: 59,000,062 I126L possibly damaging Het
Olfr598 T C 7: 103,328,825 L113P probably damaging Het
Pcdhgc4 C T 18: 37,817,322 T597M probably damaging Het
Pdrg1 A G 2: 153,015,232 probably benign Het
Per2 T A 1: 91,432,868 I521F probably benign Het
Pkhd1 G A 1: 20,201,156 L3058F probably damaging Het
Pnliprp1 A T 19: 58,734,991 probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prpf18 A T 2: 4,638,894 N155K probably benign Het
Pum1 T A 4: 130,751,484 N472K possibly damaging Het
Reln A T 5: 22,004,203 S1126T probably benign Het
Slc25a23 T A 17: 57,052,780 I324F probably damaging Het
Slc26a10 C A 10: 127,173,949 R576L probably benign Het
Slc4a1 T A 11: 102,350,314 E921D probably damaging Het
Slc9c1 A T 16: 45,554,246 M296L probably damaging Het
Sos1 T C 17: 80,433,847 D503G probably damaging Het
Srpk2 G A 5: 23,524,183 T486I possibly damaging Het
Sult6b1 A T 17: 78,894,672 probably null Het
Tbc1d16 T C 11: 119,155,091 E509G probably benign Het
Tktl2 T C 8: 66,513,398 V536A probably damaging Het
Ugt2b36 A T 5: 87,089,482 V188D probably damaging Het
Veph1 T C 3: 66,255,022 T72A probably damaging Het
Vmn2r73 A T 7: 85,869,788 I542N probably damaging Het
Vps13d G A 4: 145,167,550 P480S probably damaging Het
Zfp319 A G 8: 95,325,565 probably benign Het
Other mutations in Rnase11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Rnase11 APN 14 51049756 missense possibly damaging 0.46
IGL01024:Rnase11 APN 14 51049864 missense probably benign 0.05
R1638:Rnase11 UTSW 14 51049601 missense possibly damaging 0.92
R1809:Rnase11 UTSW 14 51049727 missense probably benign 0.00
R2844:Rnase11 UTSW 14 51049770 missense probably damaging 0.99
R7607:Rnase11 UTSW 14 51049572 missense probably damaging 0.99
R8077:Rnase11 UTSW 14 51049941 missense probably damaging 0.99
Z1176:Rnase11 UTSW 14 51049888 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGGACCTTGCACGTGGTAC -3'
(R):5'- TTGCAAAGCCTTCAGAAAGCAG -3'

Sequencing Primer
(F):5'- TGGTACGCTCCAGTCCTAG -3'
(R):5'- GCCTTCAGAAAGCAGAATGAAG -3'
Posted On2016-10-06