Incidental Mutation 'R5479:Cyp4v3'
ID434216
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Namecytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission 043040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5479 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45304944-45333216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45310206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 356 (D356V)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095328]
Predicted Effect probably benign
Transcript: ENSMUST00000095328
AA Change: D356V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: D356V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 G T 19: 55,280,462 C185F probably damaging Het
Adad2 C A 8: 119,614,915 T185N possibly damaging Het
Apbb1 A T 7: 105,565,025 V315E probably damaging Het
Arfrp1 T C 2: 181,364,398 T32A probably damaging Het
B020004C17Rik T C 14: 57,016,542 S41P probably benign Het
Celsr3 T C 9: 108,844,544 probably null Het
Chd8 C T 14: 52,215,195 G1289D probably benign Het
Ctrl A G 8: 105,933,040 F59S probably damaging Het
Dgka T A 10: 128,729,672 probably null Het
Dnah7b T C 1: 46,223,105 Y2043H probably damaging Het
Eya3 A G 4: 132,672,933 T88A possibly damaging Het
Fat1 A G 8: 45,036,875 D3608G possibly damaging Het
Fmo1 T C 1: 162,850,224 T108A probably damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Ftcd A T 10: 76,578,016 M85L probably benign Het
Ggnbp2 T C 11: 84,854,343 S189G probably benign Het
Gm10251 C T 14: 6,675,781 R35H unknown Het
Gnai2 T G 9: 107,635,166 M18L probably benign Het
Gpx5 T C 13: 21,292,635 Y9C probably benign Het
Grik1 C A 16: 87,936,026 A668S probably damaging Het
Hectd4 A T 5: 121,306,948 M83L probably benign Het
Klra9 T C 6: 130,179,112 R227G probably benign Het
Maz A T 7: 127,025,688 V197D possibly damaging Het
Mbd5 T C 2: 49,272,905 V241A probably damaging Het
Mdga2 C T 12: 66,655,176 C417Y probably damaging Het
Mios C T 6: 8,215,314 T170I probably benign Het
Myh13 G A 11: 67,348,822 A733T probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfs1 G A 2: 156,128,502 T297I probably damaging Het
Nrbf2 A G 10: 67,285,091 probably null Het
Nrg1 T C 8: 31,818,377 Y537C probably damaging Het
Olfr1208 T C 2: 88,896,691 D302G probably benign Het
Onecut3 T A 10: 80,514,022 L450Q probably damaging Het
Pard3 G A 8: 127,370,355 R333Q probably damaging Het
Parp4 T C 14: 56,624,095 F962L probably benign Het
Pilra A G 5: 137,836,056 S22P possibly damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Plxna2 G A 1: 194,793,873 D1134N probably benign Het
Pnpla7 T C 2: 25,019,441 V681A possibly damaging Het
Ppfibp1 T A 6: 147,030,150 probably null Het
Ptprz1 C T 6: 23,001,666 L1252F probably benign Het
Sptb T C 12: 76,599,851 E1999G probably benign Het
Stat3 T C 11: 100,889,888 probably benign Het
Usp25 T C 16: 77,107,913 V789A possibly damaging Het
Zfp148 C A 16: 33,497,219 Q712K probably damaging Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45307003 missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45307021 missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45320615 missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45308374 splice site probably null
IGL02565:Cyp4v3 APN 8 45320637 missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45308716 missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45308651 unclassified probably benign
R1818:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45306952 missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45317776 missense probably benign
R3747:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3748:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3750:Cyp4v3 UTSW 8 45315708 nonsense probably null
R4289:Cyp4v3 UTSW 8 45328223 missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45306992 missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45320637 missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45306980 missense probably damaging 1.00
R5667:Cyp4v3 UTSW 8 45308535 missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45321784 missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45320160 missense probably damaging 1.00
R6470:Cyp4v3 UTSW 8 45317736 nonsense probably null
R6592:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R6700:Cyp4v3 UTSW 8 45307093 missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45310252 missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45321750 missense probably benign 0.01
R7966:Cyp4v3 UTSW 8 45332917 missense probably benign 0.44
R8331:Cyp4v3 UTSW 8 45315708 nonsense probably null
R8886:Cyp4v3 UTSW 8 45321748 nonsense probably null
R8955:Cyp4v3 UTSW 8 45308527 missense probably benign 0.00
R8957:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTGGGATAGTCACATGTCAGG -3'
(R):5'- ACACTGAAGCTGTGAGAAGC -3'

Sequencing Primer
(F):5'- ATGCCTGCTAGGGAATTCAC -3'
(R):5'- GCAGAGTGCGTTCAGTTTCTTCC -3'
Posted On2016-10-06