Incidental Mutation 'R5479:Parp4'
ID 434236
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Name poly (ADP-ribose) polymerase family, member 4
Synonyms p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission 043040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R5479 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56575619-56659794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56624095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 962 (F962L)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
AlphaFold E9PYK3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161382
Predicted Effect probably benign
Transcript: ENSMUST00000161553
AA Change: F962L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: F962L

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162231
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 G T 19: 55,280,462 C185F probably damaging Het
Adad2 C A 8: 119,614,915 T185N possibly damaging Het
Apbb1 A T 7: 105,565,025 V315E probably damaging Het
Arfrp1 T C 2: 181,364,398 T32A probably damaging Het
B020004C17Rik T C 14: 57,016,542 S41P probably benign Het
Celsr3 T C 9: 108,844,544 probably null Het
Chd8 C T 14: 52,215,195 G1289D probably benign Het
Ctrl A G 8: 105,933,040 F59S probably damaging Het
Cyp4v3 T A 8: 45,310,206 D356V probably benign Het
Dgka T A 10: 128,729,672 probably null Het
Dnah7b T C 1: 46,223,105 Y2043H probably damaging Het
Eya3 A G 4: 132,672,933 T88A possibly damaging Het
Fat1 A G 8: 45,036,875 D3608G possibly damaging Het
Fmo1 T C 1: 162,850,224 T108A probably damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Ftcd A T 10: 76,578,016 M85L probably benign Het
Ggnbp2 T C 11: 84,854,343 S189G probably benign Het
Gm10251 C T 14: 6,675,781 R35H unknown Het
Gnai2 T G 9: 107,635,166 M18L probably benign Het
Gpx5 T C 13: 21,292,635 Y9C probably benign Het
Grik1 C A 16: 87,936,026 A668S probably damaging Het
Hectd4 A T 5: 121,306,948 M83L probably benign Het
Klra9 T C 6: 130,179,112 R227G probably benign Het
Maz A T 7: 127,025,688 V197D possibly damaging Het
Mbd5 T C 2: 49,272,905 V241A probably damaging Het
Mdga2 C T 12: 66,655,176 C417Y probably damaging Het
Mios C T 6: 8,215,314 T170I probably benign Het
Myh13 G A 11: 67,348,822 A733T probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfs1 G A 2: 156,128,502 T297I probably damaging Het
Nrbf2 A G 10: 67,285,091 probably null Het
Nrg1 T C 8: 31,818,377 Y537C probably damaging Het
Olfr1208 T C 2: 88,896,691 D302G probably benign Het
Onecut3 T A 10: 80,514,022 L450Q probably damaging Het
Pard3 G A 8: 127,370,355 R333Q probably damaging Het
Pilra A G 5: 137,836,056 S22P possibly damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Plxna2 G A 1: 194,793,873 D1134N probably benign Het
Pnpla7 T C 2: 25,019,441 V681A possibly damaging Het
Ppfibp1 T A 6: 147,030,150 probably null Het
Ptprz1 C T 6: 23,001,666 L1252F probably benign Het
Sptb T C 12: 76,599,851 E1999G probably benign Het
Stat3 T C 11: 100,889,888 probably benign Het
Usp25 T C 16: 77,107,913 V789A possibly damaging Het
Zfp148 C A 16: 33,497,219 Q712K probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
poisonous UTSW 14 56635748 missense possibly damaging 0.65
R0515_Parp4_195 UTSW 14 56613667 missense probably damaging 1.00
toxic UTSW 14 56629158 missense probably benign 0.28
venomous UTSW 14 56589898 missense possibly damaging 0.92
virulent UTSW 14 56587778 missense probably damaging 0.97
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56659348 missense unknown
R7960:Parp4 UTSW 14 56595251 splice site probably null
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
R8344:Parp4 UTSW 14 56648729 missense unknown
R8416:Parp4 UTSW 14 56587814 critical splice donor site probably null
R8726:Parp4 UTSW 14 56629099 missense probably benign 0.04
R8752:Parp4 UTSW 14 56648616 missense unknown
R8804:Parp4 UTSW 14 56616443 nonsense probably null
R9046:Parp4 UTSW 14 56627470 missense probably damaging 0.98
R9176:Parp4 UTSW 14 56635817 missense possibly damaging 0.54
R9303:Parp4 UTSW 14 56595333 frame shift probably null
R9303:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9305:Parp4 UTSW 14 56595333 frame shift probably null
R9305:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9360:Parp4 UTSW 14 56641318 critical splice donor site probably null
R9430:Parp4 UTSW 14 56629216 missense probably damaging 1.00
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCATTACTCTGTGGGTGC -3'
(R):5'- CAAGCTTGCAAAGTTCCCAG -3'

Sequencing Primer
(F):5'- CTGAAGGGAGCCTTAATTCGTCAAC -3'
(R):5'- GTTCCCAGACAAACTAAAGACTTGTC -3'
Posted On 2016-10-06