Incidental Mutation 'R5479:B020004C17Rik'
ID 434237
Institutional Source Beutler Lab
Gene Symbol B020004C17Rik
Ensembl Gene ENSMUSG00000096144
Gene Name RIKEN cDNA B020004C17 gene
Synonyms
MMRRC Submission 043040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R5479 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 57015134-57018982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57016542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000137042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178161]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000178161
AA Change: S41P

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137042
Gene: ENSMUSG00000096144
AA Change: S41P

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225045
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 G T 19: 55,280,462 C185F probably damaging Het
Adad2 C A 8: 119,614,915 T185N possibly damaging Het
Apbb1 A T 7: 105,565,025 V315E probably damaging Het
Arfrp1 T C 2: 181,364,398 T32A probably damaging Het
Celsr3 T C 9: 108,844,544 probably null Het
Chd8 C T 14: 52,215,195 G1289D probably benign Het
Ctrl A G 8: 105,933,040 F59S probably damaging Het
Cyp4v3 T A 8: 45,310,206 D356V probably benign Het
Dgka T A 10: 128,729,672 probably null Het
Dnah7b T C 1: 46,223,105 Y2043H probably damaging Het
Eya3 A G 4: 132,672,933 T88A possibly damaging Het
Fat1 A G 8: 45,036,875 D3608G possibly damaging Het
Fmo1 T C 1: 162,850,224 T108A probably damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Ftcd A T 10: 76,578,016 M85L probably benign Het
Ggnbp2 T C 11: 84,854,343 S189G probably benign Het
Gm10251 C T 14: 6,675,781 R35H unknown Het
Gnai2 T G 9: 107,635,166 M18L probably benign Het
Gpx5 T C 13: 21,292,635 Y9C probably benign Het
Grik1 C A 16: 87,936,026 A668S probably damaging Het
Hectd4 A T 5: 121,306,948 M83L probably benign Het
Klra9 T C 6: 130,179,112 R227G probably benign Het
Maz A T 7: 127,025,688 V197D possibly damaging Het
Mbd5 T C 2: 49,272,905 V241A probably damaging Het
Mdga2 C T 12: 66,655,176 C417Y probably damaging Het
Mios C T 6: 8,215,314 T170I probably benign Het
Myh13 G A 11: 67,348,822 A733T probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfs1 G A 2: 156,128,502 T297I probably damaging Het
Nrbf2 A G 10: 67,285,091 probably null Het
Nrg1 T C 8: 31,818,377 Y537C probably damaging Het
Olfr1208 T C 2: 88,896,691 D302G probably benign Het
Onecut3 T A 10: 80,514,022 L450Q probably damaging Het
Pard3 G A 8: 127,370,355 R333Q probably damaging Het
Parp4 T C 14: 56,624,095 F962L probably benign Het
Pilra A G 5: 137,836,056 S22P possibly damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Plxna2 G A 1: 194,793,873 D1134N probably benign Het
Pnpla7 T C 2: 25,019,441 V681A possibly damaging Het
Ppfibp1 T A 6: 147,030,150 probably null Het
Ptprz1 C T 6: 23,001,666 L1252F probably benign Het
Sptb T C 12: 76,599,851 E1999G probably benign Het
Stat3 T C 11: 100,889,888 probably benign Het
Usp25 T C 16: 77,107,913 V789A possibly damaging Het
Zfp148 C A 16: 33,497,219 Q712K probably damaging Het
Other mutations in B020004C17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:B020004C17Rik APN 14 57016023 missense probably damaging 0.96
IGL03396:B020004C17Rik APN 14 57016536 missense possibly damaging 0.61
R0664:B020004C17Rik UTSW 14 57016768 missense possibly damaging 0.56
R3977:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3978:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3979:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R4415:B020004C17Rik UTSW 14 57017417 makesense probably null
R5290:B020004C17Rik UTSW 14 57016579 missense possibly damaging 0.94
R5651:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5655:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5736:B020004C17Rik UTSW 14 57017366 missense possibly damaging 0.66
R7368:B020004C17Rik UTSW 14 57017316 missense possibly damaging 0.95
R7759:B020004C17Rik UTSW 14 57016785 missense possibly damaging 0.96
R9299:B020004C17Rik UTSW 14 57016773 missense probably damaging 0.96
R9410:B020004C17Rik UTSW 14 57016816 missense possibly damaging 0.92
Z1177:B020004C17Rik UTSW 14 57015260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCAATGAGTGTACTTCTTGCTG -3'
(R):5'- GTGTGTGCAGGTCCTTCATC -3'

Sequencing Primer
(F):5'- CTGTAACAGGGCTGGTAAGACTG -3'
(R):5'- TTCATCTTCACCATCACATCAAGG -3'
Posted On 2016-10-06